BBa_K1394001 1 BBa_K1394001 Linear Magainin 1 peptide 2014-10-04T11:00:00Z 2016-02-03T10:54:34Z The sequence for Magainin 1 was generated by reverse translating the amino acid sequence for the peptide and then codon optimising it. This gene was then synthesised. The SUMO protein fusion partner was derived from the SUMO biobrick introduced by TU Delft 2013. This partcodes for their Magainin 1 antimicrobial peptide. It includes a SUMO fusion partner to allow soluble, non-toxic expression of the gene in E. coli. false false _1553_1771_ 4206 17889 9 In stock false Because Magainin 1 is normally cytotoxic to E. coli and other bacteria, the SUMO fusion partner is critical to successful expression of the construct. Without SUMO, the antimicrobial peptide would likely lyse the cell membrane. false Sean Lowe annotation2427839 1 RBS range2427839 1 24 27 annotation2427943 1 BBa_K731721 range2427943 1 420 467 annotation2427838 1 T7 promoter range2427838 1 1 20 annotation2427946 1 T7 terminator range2427946 1 420 467 annotation2427945 1 Magainin I Antimicrobial Peptide range2427945 1 345 419 annotation2427944 1 HIS-tagged SUMO Protein range2427944 1 33 344 annotation2427836 1 BBa_K525998 range2427836 1 1 32 annotation2427837 1 B0034 range2427837 1 21 32 BBa_K1394001_sequence 1 taatacgactcactatagggaaagaggagaaaatgcatcatcatcatcatcattcggactcagaagtcaatcaagaagctaagccagaggtcaagccagaagtcaagcctgagactcacatcaatttaaaggtgtccgatggatcttcagagatcttcttcaagatcaaaaagaccactcctttaagaaggctgatggaagcgttcgctaaacgtcagggtaaggaaatggactccttaagattcttgtacgacggtattaggattcaagctgatcagacccctgaagatttggacatggatgataacgatattattgaggctcacagagaacagaccggtggtggtattggtaaatttctgcatagcgcaggtaaatttggtaaagcctttgtgggcgaaatcatgaaaagctgataactagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z