BBa_K1394002 1 BBa_K1394002 MAP star peptide 2014-10-04T11:00:00Z 2015-05-08T01:10:15Z The peptide is completely synthetic and was designed by the University of Melbourne iGEM team. It is expressed with the fusion partner, SUMO, to improve solubility. The SUMO protein sequence was derived from the work of TU Delft 2013 iGEM. The DNA sequence for this protein was codon optimised for E. coli. This part codes for a novel star peptide design by the 2013 University of Melbourne iGEM team. The peptide was designed in such a way that it can be functionalised using chemical techniques with various biomacromolecules. false false _1553_1771_ 0 17889 9 It's complicated false The protein was designed to both be highly soluble and lacking sequences which would make it prone to proteolytic degradation. false Sean Lowe annotation2427955 1 T7 terminator range2427955 1 733 812 annotation2427957 1 USP protein range2427957 1 345 732 annotation2427950 1 BBa_K525998 range2427950 1 1 32 annotation2427956 1 BBa_K731721 range2427956 1 733 812 annotation2427954 1 HIS-tagged SUMO Protein range2427954 1 33 344 annotation2427951 1 T7 promoter range2427951 1 1 32 annotation2427953 1 RBS range2427953 1 24 27 annotation2427952 1 B0034 range2427952 1 21 32 BBa_K1394002_sequence 1 taatacgactcactatagggaaagaggagaaaatgcaccaccaccaccaccactctgactctgaagttaaccaggaagcgaaaccggaagttaaaccggaagttaaaccggaaacccacatcaacctgaaagtttctgacggttcttctgaaatcttcttcaaaatcaaaaaaaccaccccgctgcgtcgtctgatggaagcgttcgcgaaacgtcagggtaaagaaatggactctctgcgtttcctgtacgacggtatccgtatccaggcggaccagaccccggaagacctggacatggacgacaacgacatcatcgaagcgcaccgtgaacagaccggtggtagccgtttcaaatttggtgaaaaatttcgcttcggcaaaaacgagtttcgctttggtaaaaccgatttcaaattcggcgataatgaatttcggtttggcaaagatttccgcttcggtaaagagaaatttcgttttggtcgtgacgactttaaattcggctattggtattgctattggtttaaattcggtcgtggtcgtgcctttcgtagcgaaccggatggtggttttcgtttcggttattattgctactggtatttccgttttgggaaagaaaacttcaaatttggcgagcaggataaattccgctttggaaatgacttccgtttcggtgaacggttcaaattcggtaacgacaaattcaaatttggggatcgcgaatttcggttcggtaaaaccaaattccgttttggcttttaatgactagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z