BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961224 1 -35 range1961224 1 137 142 annotation1961227 1 start range1961227 1 173 173 annotation1961225 1 -10 range1961225 1 161 166 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_K1398001 1 BBa_K1398001 XenB (Inducible Construct) 2014-08-10T11:00:00Z 2015-05-08T01:10:15Z The original source of XenB was Pseudomonas putida. The regulatory sequences were acquired from the iGEM repository. A construct created to degraded TNT and nitroglycerine. The construct contains the coding sequence for XenB (BBa_K1398000), an enzyme with the capability to degrade nitro- groups in chemicals. The construct also contains an inducible promoter (BBa_R0010), a strong RBS (BBa_B0034) and a double terminator (BBa_B0010). The protein has been codon-optimised for expression in E. coli. false false _1776_ 0 19951 9 It's complicated false This construct was created to allow for the over-expression of XenB, so it contains high expression regulatory sequences. A lactose inducible promoter has been used to give control over expression. false Exeter iGEM 2014 component2380394 1 BBa_K1398000 component2380393 1 BBa_B0034 component2380401 1 BBa_B0015 component2380385 1 BBa_R0010 annotation2380394 1 BBa_K1398000 range2380394 1 227 1291 annotation2380385 1 BBa_R0010 range2380385 1 1 200 annotation2380401 1 BBa_B0015 range2380401 1 1300 1428 annotation2380393 1 BBa_B0034 range2380393 1 209 220 BBa_K1398000 1 XenB XenB (Xenobiotic Reductase B) 2014-08-06T11:00:00Z 2015-05-08T01:10:15Z Source of original sequence: Pseudomonas putida BIRD-1. Xenobiotic Reductase B, created for use as a Trinitrotoluene and Nitroglycerine degrading protein. A monomeric flavin that can reduce certain nitro- groups to nitrate-. Increases the resistance of organisms to the toxic effects of nitrocompounds. This sequence encodes for a protein (with an attached His (x6) Tag to allow for purification) and nothing else. It therefore requires regulatory sequences (promoter/RBS/terminator) to be added for expression. false false _1776_ 0 19951 9 Not in stock false The original sequence of this part was found using the NCBI database and taken from Pseudomonas putida BIRD-1. The sequence was then codon-optimised for increased expression in E. coli. This has resulted in a novel synthetic sequence. false Exeter iGEM 2014 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1398001_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatggcgacgatctttgatccgatcaaactgggtgacctggaactgagcaaccgtatcattatggcgccgttaacgcgttgccgtgcggacgagggtcgtgtgccgaacgcgctgatggccgagtactacgttcagcgtgcgagcgccggtctgatcctgtccgaggcgaccagcgttaccccgatgggcgtgggctacccggacaccccgggtatttggagcaatgaccaagtgcgcggttggactaacatcacgaaagctgtccatgcggctggcggcaagattgtgctgcaactgtggcatgtcggtcgcatcagccacccgctgtacttgaacggcgaggcgccagtcgccccgagcgcgatccagccgaagggtcacgtgagcctggtccgtccgttggcggattacccgaccccgcgtgcattggaaacggcagaaatcgccgagattgtcgaagcataccgcacgggcgcagagaatgctaaagccgcaggctttgacggtgttgagatccacggcgcgaatggttatctgctggatcagttccttcaatcgtctaccaaccaacgcaccgacaattatggtggtagcctggagaatcgtgcgcgtctgctgctggaagtgaccgacgcagcgattgatgtttggggtgccggtcgcgtcggtgttcacctggcccctcgtgcagatagccacgacatgggcgacgataacctggcggaaactttcacgtatgtagcgcgtgagctgggcaagcgcggtattgcgttcatttgtagccgcgagaaagagggtgcagattctctgggtccgcagctcaaagaggcatttggtggcgcgtacattgcgaatgaacgcttcaccaaagattccgcaaacgcttggctggcggaaggcaaagccgatgctgtggcgttcggcgttccgtttatcgcaaacccggacttgccagcgcgtctgaaagctgatgccccgttgaatgaaccgcgtccggaactgttctatggtaagggtcctgttggctacattgactatccgaccctgcaccatcaccatcatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_K1398000_sequence 1 atggcgacgatctttgatccgatcaaactgggtgacctggaactgagcaaccgtatcattatggcgccgttaacgcgttgccgtgcggacgagggtcgtgtgccgaacgcgctgatggccgagtactacgttcagcgtgcgagcgccggtctgatcctgtccgaggcgaccagcgttaccccgatgggcgtgggctacccggacaccccgggtatttggagcaatgaccaagtgcgcggttggactaacatcacgaaagctgtccatgcggctggcggcaagattgtgctgcaactgtggcatgtcggtcgcatcagccacccgctgtacttgaacggcgaggcgccagtcgccccgagcgcgatccagccgaagggtcacgtgagcctggtccgtccgttggcggattacccgaccccgcgtgcattggaaacggcagaaatcgccgagattgtcgaagcataccgcacgggcgcagagaatgctaaagccgcaggctttgacggtgttgagatccacggcgcgaatggttatctgctggatcagttccttcaatcgtctaccaaccaacgcaccgacaattatggtggtagcctggagaatcgtgcgcgtctgctgctggaagtgaccgacgcagcgattgatgtttggggtgccggtcgcgtcggtgttcacctggcccctcgtgcagatagccacgacatgggcgacgataacctggcggaaactttcacgtatgtagcgcgtgagctgggcaagcgcggtattgcgttcatttgtagccgcgagaaagagggtgcagattctctgggtccgcagctcaaagaggcatttggtggcgcgtacattgcgaatgaacgcttcaccaaagattccgcaaacgcttggctggcggaaggcaaagccgatgctgtggcgttcggcgttccgtttatcgcaaacccggacttgccagcgcgtctgaaagctgatgccccgttgaatgaaccgcgtccggaactgttctatggtaagggtcctgttggctacattgactatccgaccctgcaccatcaccatcatcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z