BBa_K1398005 1 NemR (UIR) NemR Upstream Intergenic Region 2014-08-11T11:00:00Z 2015-05-08T01:10:15Z The origin of this region is Escherichia coli JD22799. This sequence is found upstream of several NemR regulated genes. It was created for use as a TNT-detection mechanism. It contains the bases from X+ to the start codon, which include a promoter and RBS. This region should allow regulation of gene preoducts through the detection of TNT. If it is not present NemR will bind to a specified sequence of bases and inhibit transcription. If TNT is not present NemR will not bind and transcription will complete. false false _1776_ 0 19951 9 Not in stock false When studied using bioinformatic databases, such as BLAST, the start codon is incorrectly labelled at position X+. The start codon is correctly positioned at the end of this sequence. false Exeter iGEM 2014 BBa_K1398005_sequence 1 cgactacgaaaacagccgcgacaaaacccgcgttcgtcagactggcaaattccccggcacgggctctggacgggaaagaactctaattgctccgccacttcgccctcctcagataagattattaccattattgaagctgttaatgtccaaagtagcaactttgcttgcactagaccgactggtctactacactccaacgcatgaacaaacacaccgaacatgatactcgcgaacatctcctggcgacgggcgagcaactttgcctgcaacgtggattcaccggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z