BBa_K1398008 1 NemR (RP) NemR Recognition Promoter 2014-08-11T11:00:00Z 2015-05-08T01:10:15Z The origin organism of the NemR box is Escherichia coli JD22799. The high level constitutive promoter originates from the iGEM repository. This sequences combines a high level constitutive promoter with the NemR binding box, which allows NemR to bind to DNA when no TNT is present in the cell. It was created for use as a TNT-detection mechanism. It combines BBa_J231000 with the NemR box to create a promoter that will theoretically have high levels of transcription when TNT is not present. false false _1776_ 0 19951 9 Not in stock false This a completely original part, created from two distinct regulatory sequences. It was created using standard sequence design software. false Exeter iGEM 2014 BBa_K1398008_sequence 1 ttgacgtagacctcagggtctactataatgctag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z