BBa_K1399003 1 BBa_K1399003 RFP from Discosoma striata (coral) with DAS-ssrA degradation tag 2014-09-18T11:00:00Z 2015-05-08T01:10:16Z RFP comes from part BBa_E1010, tag sequence was obtained from part BBa_M0052, but same tag was also used in paper by Andersen et al., (1998).[2] Mutant RFP from Discosoma striata (coral) (see part BBa_E1010) with added DAS-ssrA degradation tag (part BBa_M0052). The tag increases RFP turn-over rate, thus providing better temporal resolution of red fluorescence. In the same time, maximal fluorescence amplitudes will be lower as newly formed protein is degraded as soon as it is formed. The tag encodes peptide sequence AANDENYADAS and is recognized by ClpA and ClpX unfoldases and ClpX mediator SspB.[1] ClpA and ClpX then form a proteosome-like complex with ClpP protease and the protein is degraded.[1] The final three residues of the tag determines the strength of interaction with ClpX and thus the final protein degradation rate.[2] The DAS tag is reported to have low affinity to ClpX thus its mediated degradation very much depends on the concentration of SspB (ClpX mediator).[1] However, be aware that exact protein degradation rate is influenced by multiple other factors: ClpXP and ClpAP protease concentrations, protein stability, Km of binding to the protease, temperature [3]. References: [1] Flynn, J. M. et al. Overlapping recognition determinants within the ssrA degradation tag allow modulation of proteolysis. Proc. Natl. Acad. Sci. U. S. A. 98, 10584???9 (2001). [2] Andersen, J. B. et al. New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria. Appl. Environ. Microbiol. 64, 2240???6 (1998). [3] Purcell, O., Grierson, C. S., Bernardo, M. Di & Savery, N. J. Temperature dependence of ssrA-tag mediated protein degradation. J. Biol. Eng. 6, 10 (2012). false false _1777_ 0 22477 9 In stock true The tag was attached to RFP using PCR and MABEL (mutagenesis with blunt-end ligation), thus avoiding introduction of additonal residues and restriction site. Different parts of the tag are recognized by different proteins, for example, the final 3 residues (AAV in this case) are recognised by ClpX, whereas first 4 residues of the tag are required for efficient SspB binding.[1] Thus modifications of these critical residues alter the efficacy with what different proteases bind to it. false Anna Stikane annotation2383906 1 stop range2383906 1 709 711 annotation2383905 1 DAS-ssrA tag range2383905 1 676 708 annotation2383904 1 RFP range2383904 1 4 675 annotation2383903 1 start range2383903 1 1 3 annotation2383907 1 stop range2383907 1 712 714 BBa_K1399003_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgctgctgcaaacgacgaaaactacgctgacgcttcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z