BBa_K1399004 1 BBa_K1399004 GFP (mut3b) with LVA-ssrA degradation tag 2014-09-18T11:00:00Z 2015-06-01T07:07:29Z GFP comes from part E1010, the tag sequence was obtained from paper by Andersen et al., (1998).[2] GFP (mut3b) (see part BBa_E0040) with added LVA-ssrA degradation tag. The tag increases GFP turn-over rate, thus providing better temporal resolution of green fluorescence. In the same time, maximal fluorescence amplitudes will be lower as newly formed protein is degraded as soon as it is formed. The tag encodes peptide sequence AANDENYALVA and is recognized by ClpA and ClpX unfoldases and ClpX mediator SspB.[1] ClpA and ClpX then form a proteosome-like complex with ClpP protease and the protein is degraded.[1] The final three residues of the tag determines the strength of interaction with ClpX and thus the final protein degradation rate.[2] The LVA tag is reported to lead to fast protein degradation, degrading GFP with rate -0.018 per minute.[2] However, be aware that exact protein degradation rate depends on multiple factors: ClpXP and ClpAP protease and SspB mediator concentrations, protein stability, Km of binding to the protease, temperature [3]. References [1] Flynn, J. M. et al. Overlapping recognition determinants within the ssrA degradation tag allow modulation of proteolysis. Proc. Natl. Acad. Sci. U. S. A. 98, 10584???9 (2001). [2] Andersen, J. B. et al. New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria. Appl. Environ. Microbiol. 64, 2240???6 (1998). [3] Purcell, O., Grierson, C. S., Bernardo, M. Di & Savery, N. J. Temperature dependence of ssrA-tag mediated protein degradation. J. Biol. Eng. 6, 10 (2012). false false _1777_ 4206 22477 9 In stock true The tag was attached to GFP using PCR and MABEL (mutagenesis with blunt-end ligation), thus avoiding introduction of additonal residues and restriction site. Different parts of the tag are recognized by different proteins, for example, the final 3 residues (LVA in this case) are recognised by ClpX, whereas first 4 residues of the tag are required for efficient SspB binding.[1] Thus modifications of these critical residues alter the efficacy with what different proteases bind to it. false Anna Stikane annotation2383914 1 GFP (mut3b) range2383914 1 4 714 annotation2383916 1 stop range2383916 1 748 750 annotation2383917 1 stop range2383917 1 751 753 annotation2383913 1 start range2383913 1 1 3 annotation2383915 1 LVA range2383915 1 715 747 BBa_K1399004_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaagctgcaaacgacgaaaactacgctttagtagcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z