BBa_K1399006 1 BBa_K1399006 GFP (mut3b) with LAA-ssrA degradation tag 2014-09-18T11:00:00Z 2015-05-08T01:10:16Z GFP comes from part BBa_E1010, the tag sequence was obtained from part BBa_M0050. GFP (mut3b) (see part BBa_E0040) with added LAA-ssrA degradation tag (see part BBa_M0050). The tag increases GFP turn-over rate, thus providing better temporal resolution of green fluorescence. In the same time, maximal fluorescence amplitudes will be lower as newly formed protein is degraded as soon as it is formed. The tag encodes E.coli wild type ssrA peptide sequence AANDENYALAA and is recognized by ClpA and ClpX unfoldases and ClpX mediator SspB.[1] ClpA and ClpX then form a proteosome-like complex with ClpP protease and the protein is degraded.[1] The final three residues of the tag determines the strength of interaction with ClpX and thus the final protein degradation rate.[2] The LAA tag is reported to lead to fast protein degradation, degrading GFP with rate -0.018 per minute.[2] However, be aware that exact protein degradation rate depends on multiple factors: ClpXP and ClpAP protease and SspB mediator concentrations, protein stability, Km of binding to the protease, temperature [3]. ===References=== [1] Flynn, J. M. et al. Overlapping recognition determinants within the ssrA degradation tag allow modulation of proteolysis. Proc. Natl. Acad. Sci. U. S. A. 98, 10584???9 (2001). [2] Andersen, J. B. et al. New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria. Appl. Environ. Microbiol. 64, 2240???6 (1998). [3] Purcell, O., Grierson, C. S., Bernardo, M. Di & Savery, N. J. Temperature dependence of ssrA-tag mediated protein degradation. J. Biol. Eng. 6, 10 (2012). false false _1777_ 0 22477 9 In stock true The tag was attached to GFP using PCR and MABEL (mutagenesis with blunt-end ligation), thus avoiding introduction of additional residues and restriction site. Different parts of the tag are recognized by different proteins, for example, the final 3 residues (LAA in this case) are recognized by ClpX, whereas first 4 residues of the tag are required for efficient SspB binding.[1] Thus modifications of these critical residues alter the efficacy with what different proteases bind to it. false Anna Stikane annotation2383919 1 GFP (mut3b) range2383919 1 4 714 annotation2383918 1 start range2383918 1 1 3 annotation2383920 1 LAA-ssrA range2383920 1 715 747 annotation2383921 1 stop range2383921 1 748 750 annotation2383922 1 stop range2383922 1 751 753 BBa_K1399006_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaagctgcaaacgacgaaaactacgctctggctgcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z