BBa_K1399010 1 BBa_K1399010 Plac-RFP(AAV) 2014-09-18T11:00:00Z 2015-05-08T01:10:16Z Other biobrick parts Lactose/IPTG inducible promoter wuth RFP reporter tagged with AAV-ssrA degradation tag followed by terminator. The tagged RFP is actively degraded within cell, thus provides better temporal resolution of red fluorescence and promoter activity. Part was assembled using BrickClip assembly (BBF RFC 104) using other biobrick parts as templates. BrickClip assembly is a special case of more general Paperclip assembly method.[1] Reference [1] Trubitsyna, M., Michlewski, G., Cai, Y., Elfick, A. & French, C. E. PaperClip: rapid multi-part DNA assembly from existing libraries. Nucleic Acids Res. 1???8 (2014). doi:10.1093/nar/gku829 false false _1777_ 0 22477 9 In stock true no false Anna Stikane annotation2383946 1 stop range2383946 1 938 940 annotation2383936 1 -35 range2383936 1 137 142 annotation2386257 1 barcode from BBa_E1010 range2386257 1 941 965 annotation2383935 1 CAP binding site range2383935 1 89 126 annotation2383947 1 BBa_K1399000 range2383947 1 227 940 annotation2383942 1 start range2383942 1 227 229 annotation2383945 1 stop range2383945 1 935 937 annotation2383940 1 conserved range2383940 1 213 216 annotation2383934 1 end of LacI coding region (inactive) range2383934 1 1 88 annotation2383951 1 T7 TE range2383951 1 1069 1088 annotation2383950 1 BBa_B0012 range2383950 1 1062 1102 annotation2383953 1 stop range2383953 1 1095 1095 annotation2383941 1 BBa_B0034 range2383941 1 209 220 annotation2383939 1 start range2383939 1 173 173 annotation2383944 1 AAV-ssrA tag range2383944 1 902 934 annotation2383943 1 BBa_E1010 w/o stop range2383943 1 230 901 annotation2383954 1 BBa_B0015 range2383954 1 974 1102 annotation2383937 1 -10 range2383937 1 161 166 annotation2383952 1 polya range2383952 1 1089 1102 annotation2383948 1 BBa_B0010 range2383948 1 974 1053 annotation2383933 1 BBa_R0010 range2383933 1 1 200 annotation2383949 1 stem_loop range2383949 1 985 1028 annotation2383938 1 LacI binding site range2383938 1 166 200 BBa_K1399010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgctgctgcaaacgacgaaaactacgctgctgctgtttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z