BBa_K1401006 1 BBa_K1401006 MoClo Level 0 part of L3S2P21 terminator 2014-07-20T11:00:00Z 2015-05-08T01:10:16Z The sequence for L3S2P21 came from Addgene plasmid 46004. his is a MoClo level 0 part of the L3S2P21 terminator. This terminator is flanked by two MoClo fusion sites, D on the 5' end and F on the 3' side. The fusion site letters refer to 4bp fusion sites: D = AGGT;F = CGCT false false _1779_ 0 22443 9 Not in stock false N/A false Kathleen Lewis BBa_K1401006_sequence 1 aggtctcggtaccaaattccagaaaagaggcctcccgaaaggggggccttttttcgttttggtcccgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z