BBa_K1401007 1 BBa_K1401007 Tandem promoter pTet-pBad 2014-10-08T11:00:00Z 2015-05-08T01:10:16Z This was formed using BBa_R0040 and BBa_I13453 This tandem promoter was created using the MoClo assembly method. This is a Level 0 MoClo part with flanking sites A on the 5' side and site B on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. This transcriptional unit has Kanamycin resistance. The promoter is induced by atc and arabinose. The characterization data will be updated before the jamboree. false false _1779_ 0 22443 9 It's complicated false We looked through the literature and decided to attach the two promoters without any extra sequence between them false Kathleen Lewis BBa_K1401007_sequence 1 cgagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgaccgaaatgcaagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatatact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z