BBa_K1401607 1 BBa_K1401607 pLac - BCD2 - tetR 2014-10-10T11:00:00Z 2015-05-08T01:10:16Z E. Coli The parts contain the BioBricks - R0010_EB, BCD2_BC, C0040_CD and B0015_DF. All of these are MoClo variants i.e. they have MoClo flanking regions attached to each basic part. false false _1779_ 0 23227 9 Not in stock false All basic BioBricks used were transformed into MoClo variants by adding the following fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. These were then put together using the digestion-ligation MoClo reaction. false Yash Agarwal component2417136 1 BBa_K1114202 component2417143 1 BBa_K783020 component2417135 1 BBa_K1114107 component2417131 1 BBa_K783046 annotation2417131 1 BBa_K783046 range2417131 1 1 200 annotation2417143 1 BBa_K783020 range2417143 1 982 1110 annotation2417135 1 BBa_K1114107 range2417135 1 209 300 annotation2417136 1 BBa_K1114202 range2417136 1 309 973 BBa_K783046 1 BBa_K783046 This is a MoClo converted version of BBa_R0010 2012-10-01T11:00:00Z 2015-05-08T01:13:20Z BBa_R0010 Released HQ 2013 This is a MoClo converted version of BBa_R0010, which is an inverting regulator sensitive to LacI and CAP. It has two MoClo fusion sites flanking it. false false _1038_ 0 8248 9 In stock false We had to design the proper MoClo fusion sites to flank this part. false Traci Haddock annotation2214250 1 BBa_R0010 range2214250 1 1 200 annotation2214252 1 CAP binding site range2214252 1 89 126 annotation2214254 1 -10 range2214254 1 161 166 annotation2214255 1 LacI binding site range2214255 1 166 200 annotation2214251 1 end of LacI coding region (inactive) range2214251 1 1 88 annotation2214256 1 start range2214256 1 173 173 annotation2214253 1 -35 range2214253 1 137 142 BBa_K783020 1 BBa_K783020 MoClo converted version of BBa_B0015 2012-10-01T11:00:00Z 2015-05-08T01:13:20Z BBa_B0015 Released HQ 2013 This is the MoClo converted version of BBa_B0015, which is a double terminator consisting of BBa_B0010 and BBa_B0012. It has two MoClo fusion sites flanking it. false false _1038_ 0 8248 9 In stock false We had to design the proper MoClo fusion sites to flank this part. false Traci Haddock component2214216 1 BBa_B0010 component2214218 1 BBa_B0012 annotation2214218 1 BBa_B0012 range2214218 1 89 129 annotation2214216 1 BBa_B0010 range2214216 1 1 80 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K1114107 1 BBa_K1114107 Bicistronic Design RBS 2, MoClo Format with BC fusion sites 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z This part was cloned off a BCD template from Sonya Iverson. Sonya Iverson based her designs for her BCD2 part off of a paper published by <a href= ???http://www.nature.com/nmeth/journal/v10/n4/full/nmeth.2404.html????>Mutalik, et al.</a> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 1 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false false _1425_ 0 8248 9 In stock false This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 1 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false Traci Haddock annotation2361728 1 MoClo Fusion Site C range2361728 1 89 92 annotation2361724 1 BCD2 range2361724 1 5 88 annotation2361727 1 MoClo Fusion Site B range2361727 1 1 4 BBa_K1114202 1 BBa_K1114202 C0040_CD, Moclo of BBA_C0040 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z igem kit Moclo analogue of bba_c0040 with C and D fusion sites added false false _1425_ 0 13936 9 In stock false n/a false Shawn Jin BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1114202_sequence 1 aatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataaaggt BBa_K783020_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1114107_sequence 1 tactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg BBa_K1401607_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagtactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatgtactagagaatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataaaggttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K783046_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z