BBa_K1403004 1 BBa_K1403004 Tmm gene 2014-10-05T11:00:00Z 2015-05-08T01:10:17Z trimethylamine monooxygenase from a bacteria we added also the promoter Trimethylaminuria (TMAU) is a rare genetic disease causing a strong fish odor. Our project aims at engineering skin bacteria to degrade trimethylamine, the odor causing molecule, by the enzyme TMM (trimethylamine monooxygenase). false false _1781_ 0 22926 9 In stock false pSB1C3 - biobick prefix-promoter-tmm-sufix false Urszula Czerwinska component2396547 1 BBa_J23108 annotation2396547 1 BBa_J23108 range2396547 1 1 35 BBa_J23108 1 BBa_J23108 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1403004_sequence 1 ctgacagctagctcagtcctaggtataatgctagc BBa_J23108_sequence 1 ctgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z