BBa_K1403010 1 BBa_K1403010 RBS for agaA in E coli 2014-10-05T11:00:00Z 2015-05-08T01:10:17Z It comes from Salis online tool. 5'-AGGCAAACAAACACGAACAAAAAGGGGAAAGAGCT-3' RBS from Salis lab online tool. Designed to express agaA in E coli. false false _1781_ 0 22924 9 Not in stock false It has been designed for the expression of agaA gene in E coli. false Cristina Garcia-Timermans BBa_K1403010_sequence 1 aggcaaacaaacacgaacaaaaaggggaaagagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z