BBa_K1403010 1 BBa_K1403010 RBS for agaA in E coli 2014-10-05T11:00:00Z 2015-05-08T01:10:17Z It comes from Salis online tool. 5'-AGGCAAACAAACACGAACAAAAAGGGGAAAGAGCT-3' RBS from Salis lab online tool. Designed to express agaA in E coli. false false _1781_ 0 22924 9 Not in stock false It has been designed for the expression of agaA gene in E coli. false Cristina Garcia-Timermans BBa_K1403002 1 AgaA AgaA expression (3M2H-> 3H3MH) 2014-10-05T11:00:00Z 2015-05-08T01:10:17Z agaA sequence codon optimized for E coli 12 (IDT online tool) agaA is an enzyme present in Corynebacterium striatum that is the main responsible for body odor. It metabolizes 3-methyl-2-hexenoic acid into 3-hydroxy-3-methylhexanoic acid, that is a sulphure volatile compound. Name: BBa_K1403002 Description: Biobrick submission of agaA expression construct Resistances : Cm Backbone : pSB1C3 Parts: Pcons - RBS - agaA - his tag Design date: 11/June/2014 This part contains: 1) Plasmid pSB1C3: High copy BioBrick assembly plasmid. Constitutive expression. To use in E coli 2) agaA construct: - Promoter BBa_J23108 from the Anderson's promoter collection - RBS from the RBS Calculator of Salis lab specific for E coli - BioBrick Prefix + Scar from the iGEM Parts webpage - agaA sequence codon optimized for E coli 12 (IDT online tool). We checked with Geneious that there were no restriction sites for EcoRI, SpeI, XbaI and PstI. - Histidine tag: 6 Histidines in C-terminal were added -Stop codon -BioBrick scar + BioBrick suffix from the iGEM Parts webpage false false _1781_ 0 22924 9 It's complicated false Codon optimization. Check no restriction sites for EcoRI, SpeI, XbaI and PstI. false Cristina Garcia-Timermans BBa_K128005 1 His His affinity tag 2008-10-24T11:00:00Z 2015-05-08T01:09:46Z This sequence is easily recognized by many antibodies. This codes for six Histidine residues to allow for His column protein purification. It will work best if put at either the N or C terminus of your protein construct. This part uses the modified Silver BioBrick prefix and suffix to allow for protein construction. false false _178_ 0 2826 9 It's complicated false This part uses the modified Silver BioBrick prefix and suffix to allow for protein construction. true Prarthna Desai BBa_K1403018 1 BBa_K1403018 Expression of agaA in E coli 2014-10-05T11:00:00Z 2015-05-08T01:10:17Z It is the agaA sequence codon optimized for E coli. Name: BBa_K1403018 Description: Biobrick submission of agaA expression construct Resistances : Cm Parts: Promoter - RBS - agaA - his tag Design date: 11/June/2014 agaA is a gene present in Corynebacterium striatum and it is the main responsible for body odor according to the literature. It transforms 3-methyl-2-hexenoic acid into 3-hydroxy-3-methylhexanoic acid. Detailed description of the agaA cosntruct: - Promoter BBa_J23108 from the Anderson's promoter collection - RBS from the RBS Calculator of Salis lab specific for E coli - BioBrick Prefix + Scar from the iGEM Parts webpage - agaA sequence codon optimized for E coli 12 (IDT online tool). We checked with Generious that there were no restriction sites for EcoRI, SpeI, XbaI and PstI. - Histidine tag: 6 Histidines in C-terminal were added -Stop codon -BioBrick scar + BioBrick suffix from the iGEM Parts webpage false false _1781_ 0 22924 9 It's complicated false agaA sequence codon optimized for E coli 12 (IDT online tool). We checked with Generious that there were no restriction sites for EcoRI, SpeI, XbaI and PstI. false Cristina Garcia-Timermans component2396749 1 BBa_K1403002 component2396750 1 BBa_K128005 component2396748 1 BBa_K1403010 component2396747 1 BBa_J23108 annotation2396748 1 BBa_K1403010 range2396748 1 44 78 annotation2396747 1 BBa_J23108 range2396747 1 1 35 annotation2396749 1 BBa_K1403002 range2396749 1 85 1282 annotation2396750 1 BBa_K128005 range2396750 1 1291 1308 BBa_J23108 1 BBa_J23108 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1403002_sequence 1 atggcgcaagaaaaccttcagaaaatcgtggatagtttagaatcgtcacgcgcagaacgtgaagaactgtacaaatggtttcatcagcaccctgaaatgagcatgcaggagcatgaaactagcaaacgtatcgcagaggaattggagaaactgggcctcgaaccacagaatattggtgtgaccggtcaggtagcagttatcaaaaatggtgaaggaccgtcggttgcgtttcgtgccgactttgacgcgcttcctattacggaaaacacgggcctggattactctgcggatccggaactgggtatgatgcatgcctgtggccatgacctgcatactaccgccctcctgggcgcagtgcgtgccctggttgaaaataaggatctgtggagtggcacgtttattgcggtccaccaaccgggagaggagggcggtggcggggcccgtcatatggtcgacgacggtctggcggaaaagattgcggctccggatgtctgctttgctcaacatgtgtttaatgaggatccggcgtttggttatgtttttacgcccggtcgtttcctgacagcagcatccaattggcgtatccacattcatggggaaggtgggcacggtagccgtccacatttaactaaagatccgattgtggtcgcggcgtctattattaccaaattgcagaccattgttagccgcgaagtagatccgaatgaggtggcagttgtgacggtgggttccatcgaaggtggcaagagtaccaacagtattccatatacagtaaccctgggagtaaatacccgcgccagcaatgatgaactgtcggagtatgtccagaacgcgattaaacgtattgtcattgcagaatgtcaggcggcaggcattgaacaggaacctgaatttgagtatctggattccgttccggcggttatcaacgatgaagatttgaccgaacagcttatggcgcaatttcgcgagtttttcggcgaagatcaggcggtcgaaatcccgccgttatcaggatcagaagattatccgtttatcccaaacgcgtggggcgtaccgtctgttatgtggggctggtcgggttttgccgcgggtagcgacgcgccggggaaccataccgacaaattcgccccggaattgccggatgccttggaacgtgggacccaagccattctggttgctgcggccccttggttgatga BBa_J23108_sequence 1 ctgacagctagctcagtcctaggtataatgctagc BBa_K128005_sequence 1 catcatcaccatcaccac BBa_K1403018_sequence 1 ctgacagctagctcagtcctaggtataatgctagctactagagaggcaaacaaacacgaacaaaaaggggaaagagcttactagatggcgcaagaaaaccttcagaaaatcgtggatagtttagaatcgtcacgcgcagaacgtgaagaactgtacaaatggtttcatcagcaccctgaaatgagcatgcaggagcatgaaactagcaaacgtatcgcagaggaattggagaaactgggcctcgaaccacagaatattggtgtgaccggtcaggtagcagttatcaaaaatggtgaaggaccgtcggttgcgtttcgtgccgactttgacgcgcttcctattacggaaaacacgggcctggattactctgcggatccggaactgggtatgatgcatgcctgtggccatgacctgcatactaccgccctcctgggcgcagtgcgtgccctggttgaaaataaggatctgtggagtggcacgtttattgcggtccaccaaccgggagaggagggcggtggcggggcccgtcatatggtcgacgacggtctggcggaaaagattgcggctccggatgtctgctttgctcaacatgtgtttaatgaggatccggcgtttggttatgtttttacgcccggtcgtttcctgacagcagcatccaattggcgtatccacattcatggggaaggtgggcacggtagccgtccacatttaactaaagatccgattgtggtcgcggcgtctattattaccaaattgcagaccattgttagccgcgaagtagatccgaatgaggtggcagttgtgacggtgggttccatcgaaggtggcaagagtaccaacagtattccatatacagtaaccctgggagtaaatacccgcgccagcaatgatgaactgtcggagtatgtccagaacgcgattaaacgtattgtcattgcagaatgtcaggcggcaggcattgaacaggaacctgaatttgagtatctggattccgttccggcggttatcaacgatgaagatttgaccgaacagcttatggcgcaatttcgcgagtttttcggcgaagatcaggcggtcgaaatcccgccgttatcaggatcagaagattatccgtttatcccaaacgcgtggggcgtaccgtctgttatgtggggctggtcgggttttgccgcgggtagcgacgcgccggggaaccataccgacaaattcgccccggaattgccggatgccttggaacgtgggacccaagccattctggttgctgcggccccttggttgatgatactagagcatcatcaccatcaccac BBa_K1403010_sequence 1 aggcaaacaaacacgaacaaaaaggggaaagagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z