BBa_K1408000 1 BBa_K1408000 Degron (unstable protein domain) 2014-10-08T11:00:00Z 2015-05-08T01:10:18Z Protein domain Saccharomyces cerevisiae MATa2 (a=alpha). This part was obtained from the Fields Lab at the University of Washington. This protein domain when fused to a protein acts as a source of instability leading to degradation by the cell via ubiquitination. false false _1786_ 0 23343 9 In stock true Xbe1 and Spe1 restriction sites were in the original sequence obtained from the Fields Lab. The submitted part was synthesized with synonymous substitutions (silent mutations) amplified with primers containing the biobrick prefix and suffix and then digested and ligated into the iGEM vector. false Stephen A Rettie annotation2427569 1 Start Codon range2427569 1 1 3 annotation2427571 1 cds range2427571 1 1 204 annotation2427570 1 Protein range2427570 1 1 204 BBa_K1408000_sequence 1 atgaataaaatacccattaaagaccttttaaatccacaaatcacagatgagtttaaatccagcatactagacataaataaaaagctcttttctatttgctgtaatttacctaagcttccagagagtgtcaccaccgaggaagaagttgaattaagggatatattaggattcttatctagggccaacaaaaaccgtaagattaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z