BBa_R0083 1 OmpR Promoter (OmpR, positive) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z NC_000193 E. coli K12 Released HQ 2013 Positively regulated, OmpR-controlled promoter. This promoter is derived from the upstream region of ompC. Phosphorylated OmpR binds to the operator site and activates transcription. This is a truncated version of BBa_R0082. false false _1_ 0 24 7 In stock false The promoter deletes the C2 and C3 regions of BBa_R0082 (bases 37-74 in BBa_R0082) and inserts an 8-base linker before the -35 and -10 signal region. The efficacy of this promoter versus the full ompC upstream region (BBa_R0082) or the ompF upstream region (BBa_R0084) is currently unknown. The a at base 41 is mutated to t to avoid XbaI site. Speculation that this was a previous assembly site. true Stephen Lee, Roshan Kumar, Joe Levine, Ziyan Chu (Polkadorks, IAP 2004) annotation306881 1 A range306881 1 41 41 annotation301224 1 -35 range301224 1 45 50 annotation301223 1 linker range301223 1 37 44 annotation301221 1 C1 OmpR range301221 1 13 30 annotation301226 1 -10 range301226 1 68 73 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1412008 1 BBa_K1412008 Drive the E.coli engineered strain(CL-1) towards death region 2014-09-05T11:00:00Z 2015-05-08T01:10:18Z 123 123 false false _1790_ 0 22458 9 It's complicated false 123 false Yiying Lei component2392574 1 BBa_B0034 component2392572 1 BBa_R0083 component2392588 1 BBa_B0015 component2392581 1 BBa_K629003 annotation2392572 1 BBa_R0083 range2392572 1 1 78 annotation2392574 1 BBa_B0034 range2392574 1 87 98 annotation2392588 1 BBa_B0015 range2392588 1 758 886 annotation2392581 1 BBa_K629003 range2392581 1 105 749 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_K629003 1 cheZ cheZ, chemotaxis regulator, protein phosphatase for CheY 2011-10-02T11:00:00Z 2015-05-08T01:12:56Z genome of E. Coli BL21 plys strain Released HQ 2013 Polar localization is dependent on CheA-short. CheZ is a cytosolic phosphatase which functions in the chemotaxis signal transduction complex. Plays an important role in bacterial chemotaxis signal transduction pathway by accelerating the dephosphorylation of phosphorylated CheY (CheY-P). false false _801_ 0 9022 9 In stock false how to control the proper expression of cheZ false Zilong WANG, Yi ZHENG annotation2154423 1 rev primer range2154423 1 624 645 annotation2154424 1 terminator range2154424 1 643 645 annotation2155668 1 TGA to TAA range2155668 1 643 645 annotation2154422 1 start range2154422 1 1 3 annotation2154425 1 CheZ range2154425 1 1 645 annotation2154421 1 fwd primer range2154421 1 1 20 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K629003_sequence 1 atgatgcaaccatcaatcaaacctgctgacgagcattcagctggcgatatcattgcgcgcatcggcagcctgacgcgtatgctgcgcgacagtttgcgggaactggggctggatcaggccattgccgaagcggcggaagccatccccgatgcgcgcgatcgtttgtactatgttgtgcagatgaccgcccaggctgcggagcgggcgctgaacagtgttgaggcgtcacaaccgcatcaggatcaaatggagaaatcagcaaaagcgttaacccaacgttgggatgactggtttgccgatccgattgaccttgccgacgcccgtgaactggtaacagatacacgacaatttctggcagatgtacccgcgcataccagctttactaacgcgcaactgctggaaatcatgatggcgcaggattttcaggatctcaccgggcaggtcattaagcggatgatggatgtcattcaggagatcgaacgccagttgctgatggtgctgttggaaaacatcccggaacaggagtcgcgtccaaaacgtgaaaaccagagtttgcttaatggacctcaggtcgataccagcaaagccggtgtggtagccagtcaggatcaggtggacgatttgttggatagtcttggattttaa BBa_R0083_sequence 1 tcccttgcatttacattttgaaacatctatagcgatctcttgagttggattattctgcatttttggggagaatggact BBa_K1412008_sequence 1 tcccttgcatttacattttgaaacatctatagcgatctcttgagttggattattctgcatttttggggagaatggacttactagagaaagaggagaaatactagatgatgcaaccatcaatcaaacctgctgacgagcattcagctggcgatatcattgcgcgcatcggcagcctgacgcgtatgctgcgcgacagtttgcgggaactggggctggatcaggccattgccgaagcggcggaagccatccccgatgcgcgcgatcgtttgtactatgttgtgcagatgaccgcccaggctgcggagcgggcgctgaacagtgttgaggcgtcacaaccgcatcaggatcaaatggagaaatcagcaaaagcgttaacccaacgttgggatgactggtttgccgatccgattgaccttgccgacgcccgtgaactggtaacagatacacgacaatttctggcagatgtacccgcgcataccagctttactaacgcgcaactgctggaaatcatgatggcgcaggattttcaggatctcaccgggcaggtcattaagcggatgatggatgtcattcaggagatcgaacgccagttgctgatggtgctgttggaaaacatcccggaacaggagtcgcgtccaaaacgtgaaaaccagagtttgcttaatggacctcaggtcgataccagcaaagccggtgtggtagccagtcaggatcaggtggacgatttgttggatagtcttggattttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z