BBa_K1412089 1 BBa_K1412089 Riboregulator which combines crRNA and RBS acting as a lock to the gene cuicuit 2014-10-15T11:00:00Z 2015-05-08T01:10:18Z 123 123 false false _1790_ 0 22457 9 Not in stock false 123 false Yahong Chen BBa_K1412089_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacgaatttctttcttccttagttctgcctaaggaggaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z