BBa_K629003 1 cheZ cheZ, chemotaxis regulator, protein phosphatase for CheY 2011-10-02T11:00:00Z 2015-05-08T01:12:56Z genome of E. Coli BL21 plys strain Released HQ 2013 Polar localization is dependent on CheA-short. CheZ is a cytosolic phosphatase which functions in the chemotaxis signal transduction complex. Plays an important role in bacterial chemotaxis signal transduction pathway by accelerating the dephosphorylation of phosphorylated CheY (CheY-P). false false _801_ 0 9022 9 In stock false how to control the proper expression of cheZ false Zilong WANG, Yi ZHENG annotation2154422 1 start range2154422 1 1 3 annotation2154421 1 fwd primer range2154421 1 1 20 annotation2154423 1 rev primer range2154423 1 624 645 annotation2154424 1 terminator range2154424 1 643 645 annotation2155668 1 TGA to TAA range2155668 1 643 645 annotation2154425 1 CheZ range2154425 1 1 645 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K206000 1 pBAD pBAD strong 2009-10-13T11:00:00Z 2015-05-08T01:11:23Z The sequence was obtained by applying all mutations that upregulated AraC binding and subsequent promoter activity listed in reference [1]. Released HQ 2013 pBAD is an <i>E.coli</i> promoter that is induced by L-arabinose. K206000 is a mutagenized pBAD promoter that is responsive to lower concentrations of arabinose than wild type (<partinfo>I13453</partinfo>) and, additionally, exhibits a higher maximum of protein expression as measured by coupling to a fluorescent reporter. false false _307_ 0 4172 9 In stock true There were no special design considerations. false Amelia Hardjasa annotation2049252 1 promoter range2049252 1 1 131 annotation2049254 1 AraI2 range2049254 1 61 78 annotation2049253 1 AraI1 range2049253 1 40 57 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1412614 1 BBa_K1412614 Characterize the efficiency of promoter(<bbpart>BBa_K206000</bbpart>) with chemotaxis 2014-09-30T11:00:00Z 2015-05-08T01:10:18Z BBa_K206000 BBa_B0034 BBa_K629003 BBa_B0015 This part consists of a CheZ gene which can express CheZ protein deciding E.coli whether tumble or swim straight.In this light, we can characterize the efficiency of promoters by just change different promoters.Then we can characterize the efficiency of RBS via measuring the migration distance positively associated with the expression strength of CheZ. false false _1790_ 0 22460 9 In stock false 1.As a skeleton, TT terminator link with CheZ. 2.Then the skeleton CheZ-TT link to RBS. 3.Next, link RBS-CheZ-TT with promoter Plac. false Ruihua Zhang component2391555 1 BBa_B0034 component2391562 1 BBa_K629003 component2391553 1 BBa_K206000 component2391569 1 BBa_B0015 annotation2391562 1 BBa_K629003 range2391562 1 157 801 annotation2391555 1 BBa_B0034 range2391555 1 139 150 annotation2391569 1 BBa_B0015 range2391569 1 810 938 annotation2391553 1 BBa_K206000 range2391553 1 1 130 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K1412614_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagaaagaggagaaatactagatgatgcaaccatcaatcaaacctgctgacgagcattcagctggcgatatcattgcgcgcatcggcagcctgacgcgtatgctgcgcgacagtttgcgggaactggggctggatcaggccattgccgaagcggcggaagccatccccgatgcgcgcgatcgtttgtactatgttgtgcagatgaccgcccaggctgcggagcgggcgctgaacagtgttgaggcgtcacaaccgcatcaggatcaaatggagaaatcagcaaaagcgttaacccaacgttgggatgactggtttgccgatccgattgaccttgccgacgcccgtgaactggtaacagatacacgacaatttctggcagatgtacccgcgcataccagctttactaacgcgcaactgctggaaatcatgatggcgcaggattttcaggatctcaccgggcaggtcattaagcggatgatggatgtcattcaggagatcgaacgccagttgctgatggtgctgttggaaaacatcccggaacaggagtcgcgtccaaaacgtgaaaaccagagtttgcttaatggacctcaggtcgataccagcaaagccggtgtggtagccagtcaggatcaggtggacgatttgttggatagtcttggattttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K629003_sequence 1 atgatgcaaccatcaatcaaacctgctgacgagcattcagctggcgatatcattgcgcgcatcggcagcctgacgcgtatgctgcgcgacagtttgcgggaactggggctggatcaggccattgccgaagcggcggaagccatccccgatgcgcgcgatcgtttgtactatgttgtgcagatgaccgcccaggctgcggagcgggcgctgaacagtgttgaggcgtcacaaccgcatcaggatcaaatggagaaatcagcaaaagcgttaacccaacgttgggatgactggtttgccgatccgattgaccttgccgacgcccgtgaactggtaacagatacacgacaatttctggcagatgtacccgcgcataccagctttactaacgcgcaactgctggaaatcatgatggcgcaggattttcaggatctcaccgggcaggtcattaagcggatgatggatgtcattcaggagatcgaacgccagttgctgatggtgctgttggaaaacatcccggaacaggagtcgcgtccaaaacgtgaaaaccagagtttgcttaatggacctcaggtcgataccagcaaagccggtgtggtagccagtcaggatcaggtggacgatttgttggatagtcttggattttaa BBa_K206000_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z