BBa_K1412888 1 BBa_K1412888 a combination of theophylline aptamer and taRNA that can response theophylline to regular gene ci 2014-10-13T11:00:00Z 2015-05-08T01:10:18Z 123 123 false false _1790_ 0 22457 9 Not in stock false 123 false Yahong Chen annotation2418804 1 C3 OmpR range2418804 1 54 71 annotation2418805 1 -35 range2418805 1 75 80 annotation2418806 1 -10 range2418806 1 98 103 annotation2418808 1 conserved range2418808 1 121 124 annotation2418803 1 C2 OmpR range2418803 1 34 51 annotation2418807 1 BBa_R0082 range2418807 1 1 108 annotation2418809 1 BBa_B0034 range2418809 1 117 128 annotation2418802 1 C1 OmpR range2418802 1 13 30 BBa_K1412888_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacgaatttcggtgataccagcatcgtcttgatgcccttggcagcaccctgcgtaaagaaggaatcaagacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z