BBa_K1413021 1 BBa_K1413021 bphR2 mutated 2014-10-06T11:00:00Z 2015-05-08T01:10:18Z The gene was synthetized from the sequence of bphR2 (BBa_K1155009)because there isn't the sample in the registry. bphR2 gene, from Pseudomonas pseudoalcaligenes KF707, encodes for a regulatory protein (bphR2) which can detect polychlorinated biphenyls (PCBs). This gene regulates negatively bphR1 promoter involved in the transcription of biphenyl-catabolic genes (bph), degrading PCBs. In absence of PCB, bphR2 is bound to the bphR1 promoter. When compound diffuses into the cell, it binds to protein allowing a conformational change. BphR2 is release from the promoter that its allows the transcription of bph genes and therefore the degration of PCBs. Our aim was to finish and characterize the part of 2013 Paris Saclay's team. We used bphR2 in our biosensor project of PCBs. Instead of the genes of degradation, we have RFP (BBa_E1010) to detect 2 hydroxy-3',4' biphenyl. false false _1791_ 0 22651 9 In stock false Moreover, the sequence contained a pstI site from 142 to 148bp after ATG site so we have synthetized it by mutating the site, keeping the same amino acid. false Laura MATABISHI, Julie Zaworski annotation2398816 1 bphR2 range2398816 1 1 903 annotation2398817 1 mutation range2398817 1 142 147 BBa_K1413021_sequence 1 atggaactccacgacctggatttaaacctgctggtagtattcaaccagttgatggtcgacaagcgtgtctctatcgtcgcgcaaagcctaggcctaacccaacctgccgtaagcaacgccctgaagcgcctgcgcaccgcactacaggacgaactgttcgtgcgtacccaccaaggcatggaacctacgccctatgctccacatttagctgagcctatcgcccatgccatgcacagtctgcgcgaagcgctacatcacgaagagcgcttcgatcctttaaccagcgagcgtaccttcaccttggccatgaccgacattggtgagatatatttcatgccgcggttaatagatgcgctcgctcgtaaggccccccattgcacaatcagcacggtacgcggcagctcggtgagtttgggacagtcgttacaagacggtacagtagattttgccgtaggcctgctacccaacctacaggccggcttcttacagcgtcggcttcttcataaccgctacgtgtgcttgtgccgtaagaaccacccggccaccagagagccactgaccttggagcgcttctgtgcctacagccatatacgtgtcatcgccgccagcactggccacggcgaagtagattcccttatggcgcgagctggcatccggcgggacattcgcctagaggttccgcacttcgtcgccgtcggccatatcctccagcatacggagctactcgccaccgtacctgagccgttcgctgactgctgtgtagagcccttcggcttgaatgtgctgccaatccccatcgacctaccagaaatccccattaacatgttctggcacgcaaaatatcacaaggatttagccaacatctggttgcgacaactgatgttcgagctgttttcggattga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z