BBa_K1415001 1 BBa_K1415001 PBAN (Bombyx mori) 2014-10-01T11:00:00Z 2015-05-08T01:10:18Z Artificial synthesis from known amino acid sequence. n our project, we will biologically synthesize PBAN with our E.coli. We store the PBAN inside a trapping device (check this out at our Device page). In the device, there will be appropriate lighting and nutrient sources that will attract insects.Once an insect is attracted into our device and ingests the nutrient sources we provide, it will also inevitably come in contact with our PBAN, which is evenly mixed with the nutrient sources. As the PBAN works its magic and activates the pheromone synthesis of the attracted insect, more of this species of insect???s counterparts will be attracted and later captured.Owing to the first feature mentioned above, PBANs are species-specific, which means that it doesn't matter if other kind of insect fly into our device and eat PBANs, because the insects we don't want to catch will not be stimulated by PBANs to produce pheromone; our PBANs are only for what we want to catch, we are sure that our method won't affect other kinds of insects. false false _1793_ 0 22512 9 In stock false None false HO, TSUNG YU annotation2391945 1 PBAN (Bombyx mori) range2391945 1 1 109 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1415101 1 BBa_K1415101 Pcons+B0034+PBAN(Bombyx mori) 2014-10-02T11:00:00Z 2015-05-08T01:10:19Z Assembly This part has a constitutive promoter, so our PBAN(Bombyx) can constitutive express. false false _1793_ 0 22512 9 In stock false No false HO, TSUNG YU component2393960 1 BBa_J23101 component2393964 1 BBa_K1415001 component2393962 1 BBa_B0034 annotation2393964 1 BBa_K1415001 range2393964 1 62 170 annotation2393960 1 BBa_J23101 range2393960 1 1 35 annotation2393962 1 BBa_B0034 range2393962 1 44 55 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1415101_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatgctgtccgaggatatgccggcgacgccagcagaccaggagatgtatcaaccagatccggaagaaatggagtctcgtacccgttacttcagcccgcgcctgtaataat BBa_K1415001_sequence 1 atgctgtccgaggatatgccggcgacgccagcagaccaggagatgtatcaaccagatccggaagaaatggagtctcgtacccgttacttcagcccgcgcctgtaataat BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z