BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1415102 1 BBa_K1415102 Pcons+B0034+PBAN(Mamestra brassicae) 2014-10-04T11:00:00Z 2015-05-08T01:10:19Z Assemble This part has a constitutive promoter, so our PBAN(Mamestra brassicae) can constitutive express. false false _1793_ 0 22512 9 In stock true No false HO, TSUNG YU component2393955 1 BBa_J23101 component2393959 1 BBa_K1415002 component2393957 1 BBa_B0034 annotation2393955 1 BBa_J23101 range2393955 1 1 35 annotation2393957 1 BBa_B0034 range2393957 1 44 55 annotation2393959 1 BBa_K1415002 range2393959 1 62 170 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1415002 1 BBa_K1415002 PBAN (Mamestra brassicae) 2014-10-02T11:00:00Z 2015-05-08T01:10:18Z Artificial synthesis Cotton bollworm Helicoverpa armigera &#65288;Hubner&#65289; Spread:The pink bollworm has spread to cotton-growing regions throughout the world. Characteristics: The larva is green, khaki, grey-brown or brown with dark spots. The topside is darker than the bottom side and a yellow or light brown stripe goes round the middle portion by the spots. Damage: The cotton bollworm is a moth, the larvae of which feed on a wide range of plants, including many important cultivated crops. It is a major pest in cotton and one of the most polyphagous and cosmopolitan pest species. It should not be confused with the similarly named, related species Helicoverpa zea.The cotton bollworm is a highly polyphagous species.The most important crop hosts are tomato, cotton, pigeon pea, chickpea, sorghum and cowpea. Other hosts include groundnut, okra, peas, field beans, soybeans, lucerne, Phaseolus spp., other Leguminosae, tobacco, potatoes, maize, flax, Dianthus, Rosa, Pelargonium, Chrysanthemum, a number of fruit trees, forest trees and a range of vegetable crops. Control: Cultural controls, with the exception of the use of Bt cotton and the use of mating disruption and sprays of the Entrust formulation of spinosad are acceptable to use on organically grown cotton. false false _1793_ 0 22512 9 In stock true No false HO, TSUNG YU annotation2392674 1 PBAN (Mamestra brassicae) range2392674 1 1 109 BBa_K1415002_sequence 1 atgctggcggacgatatgccggccaccccagcggatcaggagatgtatcgcccagatccggagcagatcgacagccgtacgaaatacttctctccgcgtctgtaataat BBa_B0034_sequence 1 aaagaggagaaa BBa_K1415102_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatgctggcggacgatatgccggccaccccagcggatcaggagatgtatcgcccagatccggagcagatcgacagccgtacgaaatacttctctccgcgtctgtaataat BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z