BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1415003 1 BBa_K1415003 PBAN (Agrotis ipsilon) 2014-10-02T11:00:00Z 2015-05-08T01:10:18Z Artificial synthesis Black cutworm (Agrotis ipsilon) Spread: This Caterpillar can be found, as various species, throughout North America. Characteristics: Cutworms common in Georgia fields are black (Agrotis ipsilon (Ashmed)), granulate (Agrotis subterranea (Fabricius)) and variegated cutworms (Peridroma saucia(Hubner)). These are moths in the family Noctuidae. Full-grown cutworm larvae are 1.5 to 2 inches long. Coloration will vary among species, but all tend to be stout-bodied caterpillars with four sets of prolegs. They have the tendency to curl into a ball when disturbed. Damage: Almost any plant can be attacked in the seedling stage. Cotton and certain vegetables sometimes have stand reductions. Climbing cutworms, such as the granulate cutworm, can be serious foliage feeders on some crops such as peanuts. Control: Bacillus thuringiensis, a widely available caterpillar-killing bacterium,is a very effective control for climbing cutworms as well as for the surface feeders. false false _1793_ 0 22512 9 In stock false No false HO, TSUNG YU annotation2392675 1 PBAN (Agrotis ipsilon) range2392675 1 1 109 BBa_K1415103 1 BBa_K1415103 Pcons+B0034+PBAN(Agrotis ipsilon) 2014-10-04T11:00:00Z 2015-05-08T01:10:19Z Assemble This part has a constitutive promoter, so our PBAN(Agrotis ipsilon) can constitutive express. false false _1793_ 0 22512 9 In stock false No false HO, TSUNG YU component2393965 1 BBa_J23101 component2393969 1 BBa_K1415003 component2393967 1 BBa_B0034 annotation2393969 1 BBa_K1415003 range2393969 1 62 170 annotation2393965 1 BBa_J23101 range2393965 1 1 35 annotation2393967 1 BBa_B0034 range2393967 1 44 55 BBa_K1415003_sequence 1 atgctggcggacgataccccggccaccccagcggatcaggagatgtatcgcccagatccggaacagatcgacagccgtacgaaatacttttctccgcgtctgtaataat BBa_B0034_sequence 1 aaagaggagaaa BBa_K1415103_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatgctggcggacgataccccggccaccccagcggatcaggagatgtatcgcccagatccggaacagatcgacagccgtacgaaatacttttctccgcgtctgtaataat BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z