BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1415004 1 BBa_K1415004 PBAN (Lymantria dispar) 2014-10-02T11:00:00Z 2015-05-08T01:10:18Z Artificial synthesis Gypsy Moth (Lymantria dispar) Spread: It has a range which covers Europe, Africa, and North America. Characteristics:Gypsy moth caterpillars change appearance as they grow. Young caterpillars are black or brown and about ?? inch (.6 cm) in length. As they grow, bumps develop along their backs along with coarse, black hairs. Each of the 11 sections of a developed caterpillar will have two coloured spots, the first five pairs, blue, and the last six, red. Mature caterpillars can be as long as 2 ?? inches (6.35 cm). Damage: It is classified as a pest, and its larvae consume the leaves of over 500 species of trees, shrubs and plants. The gypsy moth is one of the most destructive pests of hardwood trees in the eastern United States.he gypsy moth was considered a nuisance just ten years after their release. It included an account of all the trees being defoliated, caterpillars covering houses and sidewalks and that the caterpillars would rain down upon residents. The first outbreak occurred in 1889. An eradication program was begun in 1890. Control: Tanglefoot Pest Barrier or Sticky Tree Bands can be placed around tree trunks to help curtail the caterpillars movement into and out of the tree canopy. Apply Bacillus thuringiensis, var. kurstaki or Monterey Garden Insect Spray (Spinosad) to the leaves of trees to kill gypsy moth caterpillars. false false _1793_ 0 22512 9 In stock false No false HO, TSUNG YU annotation2392676 1 PBAN (Lymantria dispar) range2392676 1 1 109 BBa_K1415104 1 BBa_K1415104 Pcons+B0034+PBAN(Lymantria dispar) 2014-10-04T11:00:00Z 2015-05-08T01:10:19Z Assemble This part has a constitutive promoter, so our PBAN(Lymantria dispar) can constitutive express. false false _1793_ 0 22512 9 In stock false No false HO, TSUNG YU component2393972 1 BBa_B0034 component2393974 1 BBa_K1415004 component2393970 1 BBa_J23101 annotation2393974 1 BBa_K1415004 range2393974 1 62 170 annotation2393970 1 BBa_J23101 range2393970 1 1 35 annotation2393972 1 BBa_B0034 range2393972 1 44 55 BBa_K1415104_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatgctggcggacgatatgccggccacgatggcggaccaggaagtgtatcgcccagagccggaacaaattgattctcgtaataaatactttagcccgcgcctgtaataat BBa_B0034_sequence 1 aaagaggagaaa BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_K1415004_sequence 1 atgctggcggacgatatgccggccacgatggcggaccaggaagtgtatcgcccagagccggaacaaattgattctcgtaataaatactttagcccgcgcctgtaataat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z