BBa_K1415105 1 BBa_K1415105 Pcons+B0034+PBAN(Spodoptera litura) 2014-10-04T11:00:00Z 2015-05-08T01:10:19Z Assemble This part has a constitutive promoter, so our PBAN(Spodoptera litura) can constitutive express. false false _1793_ 0 22512 9 In stock true No false HO, TSUNG YU component2393977 1 BBa_B0034 component2393979 1 BBa_K1415005 component2393975 1 BBa_J23101 annotation2393977 1 BBa_B0034 range2393977 1 44 55 annotation2393975 1 BBa_J23101 range2393975 1 1 35 annotation2393979 1 BBa_K1415005 range2393979 1 62 170 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1415005 1 BBa_K1415005 PBAN (Spodoptera litura) 2014-10-02T11:00:00Z 2015-05-08T01:10:19Z Artificial synthesis Oriental Leafworm Moth (Spodoptera litura) Spread:It is found in the Indo-Australian tropics. It is also established on most Polynesian islands where it occurs in a variety of island forms. Characteristics: Adult moths measure between 15-20 mm (0.59-0.79 inches) in length and have a wingspan of 30-38 mm (1.18-1.5 inches). Forewings are gray to reddish-brown, with a complex pattern of creamy streaks and paler lines along the veins. Hind wings are grayish-white with grayish-brown margins. Males have a blue-grey band from the upper corner (apex) to the inner margin of each forewing. Larvae have bright yellow stripes along the back and the sides. Larval color varies from pale green to dark green, Damage: Oriental Leafworm Moth Spodoptera litura is a Noctuid moth which is considered as an agricultural pest. It is also known as the Cluster caterpillar, Cotton leafworm, Tobacco cutworm, and Tropical armyworm. It has a very wide host range of over 120 plant species, including: lettuce, cabbage, beetroot, peanuts, geranium, cotton, banana, fuchsias, acacia, African oil palm, amaranth, alfalfa, strawberry, sorghum, sugarcane, tomatoes, asparagus, apple, eggplant, beet, beans, broccoli, elephants ear, horsetail she oak, corn, flax, lantana, papaya, orange, mango, leek, among many others. Control: The use of Bacillus thuringiensis (BT) may effectively control this pest. Other forms of biological, horticultural, and cultural control that have been studied include: planting near derris and garlic plants, breeding resistant plants from wild plants for example groundnuts from wild groundnuts, breeding resistant plants using bacterium Bacillus thuringiensis genes, using a Baculovirus, using the nematode Steinernema carpocapsae, and using the fly Exorista japonica. false false _1793_ 0 22512 9 In stock true No false HO, TSUNG YU annotation2392677 1 PBAN (Spodoptera litura) range2392677 1 1 109 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1415005_sequence 1 atgctggcggacgatatgccggcgaccccggccgatcaggaactgtaccgtccagacccggatcaaatcgacagccgtaccaaatatttttctccacgcctgtaataat BBa_K1415105_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatgctggcggacgatatgccggcgaccccggccgatcaggaactgtaccgtccagacccggatcaaatcgacagccgtaccaaatatttttctccacgcctgtaataat BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z