BBa_K1415107 1 BBa_K1415107 Pcons+B0034+PBAN(Adoxophyes sp.) 2014-10-04T11:00:00Z 2015-05-08T01:10:19Z Assemble This part has a constitutive promoter, so our PBAN(Adoxophyes sp.) can constitutive express. false false _1793_ 0 22512 9 In stock false No false HO, TSUNG YU component2393985 1 BBa_J23101 component2393987 1 BBa_B0034 component2393989 1 BBa_K1415007 annotation2393989 1 BBa_K1415007 range2393989 1 62 164 annotation2393985 1 BBa_J23101 range2393985 1 1 35 annotation2393987 1 BBa_B0034 range2393987 1 44 55 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1415007 1 BBa_K1415007 PBAN (Adoxophyes sp.) 2014-10-02T11:00:00Z 2015-05-08T01:10:19Z Artificial synthesis Leafrollers (Adoxophyes sp.) Spread: The obliquebanded leafroller (OBLR) is native to and widely distributed throughout temperate North America. Characteristics: hatched larvae have a yellowish green body and a black head and thoracic shield. Mature larvae are 20 to 25 mm in length and the head and thoracic shield may be either black or various shades of brown. Damage: Leafrollers, the larvae of certain tortricid moths, often feed and pupate within the protection of rolled-up leaves. Several species can cause problems on fruit and ornamental trees in California. The fruittree leafroller, Archips argyrospila, is the most common leafroller pest in landscapes throughout the state. It occurs on many ornamental trees???including ash, birch, California buckeye, box elder, elm, locust, maple, poplar, rose, and willow???and is particularly damaging to deciduous and live oaks. It also attacks numerous fruit and nut trees including almond, apple, apricot, caneberries, cherry, citrus, pear, plum, prune, quince, and walnut. Control(1) Several parasites attack OBLR larvae but do not adequately control the pest.(2) Apply sprays during June to kill the first summer brood adults and newly hatching larvae. false false _1793_ 0 22512 9 In stock false No false HO, TSUNG YU annotation2392715 1 PBAN (Adoxophyes sp.) range2392715 1 1 103 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1415107_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatgcagagcgaagcggtgaccagctctgatgagcaagtgtatcgtcaggacatgagcccggtcgatggccgcctgaaatacttttctccgcgcctgtaataat BBa_B0034_sequence 1 aaagaggagaaa BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_K1415007_sequence 1 atgcagagcgaagcggtgaccagctctgatgagcaagtgtatcgtcaggacatgagcccggtcgatggccgcctgaaatacttttctccgcgcctgtaataat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z