BBa_K1415008 1 BBa_K1415008 PBAN (Solenopsis invicta) 2014-10-02T11:00:00Z 2015-05-08T01:10:19Z Artificial synthesis Red imported fire ant (Solenopsis invicta) Spread:The red imported fire ant, a eusocial species, are far more aggressive than most ant species. Animals, including humans, often encounter them by inadvertently stepping on one of their mounds, which causes the ants to swarm up the legs, attacking en masse. The ants respond to pheromones released by the first ant that attacks, thereafter stinging in concert. Characteristics: Fire ants are red and black in coloration and, like all insects, they are protected by a hard exoskeleton and have six legs. Worker ants have round heads with mandibles, an armored thorax midsection and an abdomen, made up of the pedicle and the gaster. The head is typically copper brown in color. In addition to their mandibles, fire ant workers also possess an abdominal stinger. Damage: They are considered to be a pest, not only because of the physical pain they can inflict, but also because their mound-building activity can damage plant roots, lead to loss of crops Control:(2) Hot water Pouring hot water on the mounds is effective and environmentally friendly, but may require 3 or 4 applications to kill the colony. Water should be at least scalding hot, but does not need to be boiling. This works best when you use 3 to 4 gallons of water in each application. WARNING: Hot water kills grass and shrubbery and may cause severe burns if spilled. (2)Liquid nitrogen: it could be the most effective and most environmental friendly method to eradicate the species. false false _1793_ 0 22254 9 In stock false No false Min-Chien Hsiao annotation2392763 1 PBAN (Solenopsis invicta) range2392763 1 1 88 BBa_K1415108 1 BBa_K1415108 Pcons+B0034+PBAN(Solenopsis invicta) 2014-10-04T11:00:00Z 2015-05-08T01:10:19Z Assemble This part has a constitutive promoter, so our PBAN(Solenopsis invicta) can constitutive express. false false _1793_ 0 22512 9 In stock false No false HO, TSUNG YU component2393997 1 BBa_B0034 component2393995 1 BBa_J23101 component2393999 1 BBa_K1415008 annotation2393999 1 BBa_K1415008 range2393999 1 62 149 annotation2393995 1 BBa_J23101 range2393995 1 1 35 annotation2393997 1 BBa_B0034 range2393997 1 44 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0034_sequence 1 aaagaggagaaa BBa_K1415108_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatgggcagcggtgaagatctgtcttacggcgacgcgtatgaggttgatgaagacgatcatccgctgtttgtgccgcgtctgtaataat BBa_K1415008_sequence 1 atgggcagcggtgaagatctgtcttacggcgacgcgtatgaggttgatgaagacgatcatccgctgtttgtgccgcgtctgtaataat BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z