BBa_K1415109 1 BBa_K1415109 Pcons+B0034+PBAN(Aedes aegypti) 2014-10-04T11:00:00Z 2015-05-08T01:10:19Z Assemble This part has a constitutive promoter, so our PBAN( Aedes aegypti) can constitutive express. false false _1793_ 0 22512 9 In stock false No false HO, TSUNG YU component2394002 1 BBa_B0034 component2394000 1 BBa_J23101 component2394004 1 BBa_K1415009 annotation2394002 1 BBa_B0034 range2394002 1 44 55 annotation2394004 1 BBa_K1415009 range2394004 1 62 125 annotation2394000 1 BBa_J23101 range2394000 1 1 35 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1415009 1 BBa_K1415009 PBAN (Aedes aegypti) 2014-10-02T11:00:00Z 2015-05-08T01:10:19Z Artificial synthesis Yellow fever mosquito (Aedes aegypyi) Spread:The yellow fever mosquito, Aedes aegypti, is a mosquito that can spread the dengue fever, chikungunya, and yellow fever viruses, and other diseases. The mosquito can be recognized by white markings on its legs and a marking in the form of a lyre on the thorax. The mosquito originated in Africa, but is now found in tropical and subtropical regions throughout the world. Characteristics: The mosquito can be recognized by white markings on its legs and a marking in the form of a lyre on the thorax. Damage: The yellow fever mosquito, Aedes aegypti, is a mosquito that can spread the dengue fever, chikungunya, and yellow fever viruses, and other diseases. Control:(1) Empty water from containers such as flower pots, birdbaths, pet water dishes, cans, gutters, tires and buckets regularly to disrupt the mosquito breeding cycle. (2)Consider using an insect repellent, be sure to follow the label directions for applying the repellent. For help selecting a mosquito repellent, try our Insect Repellent Locator. false false _1793_ 0 22512 9 In stock false No false HO, TSUNG YU annotation2392811 1 PBAN (Aedes aegypti) range2392811 1 1 64 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1415109_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatggacgcgagcagtagcaacgaaaataacagccgcccgccgtttgccccgcgtctgtaataat BBa_K1415009_sequence 1 atggacgcgagcagtagcaacgaaaataacagccgcccgccgtttgccccgcgtctgtaataat BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z