BBa_K1415205 1 BBa_K1415205 Pcons+B0034+PBAN(Spodoptera litura)+B0034+BFP+J61048 2014-10-04T11:00:00Z 2015-05-08T01:10:20Z Assemble We use this part as reporter gene, it can check whether our PBAN works and quantify its expression. false false _1793_ 0 22512 9 It's complicated true No false HO, TSUNG YU component2394061 1 BBa_K592100 component2394055 1 BBa_B0034 component2394053 1 BBa_J23101 component2394062 1 BBa_J61048 component2394057 1 BBa_K1415005 component2394059 1 BBa_B0034 annotation2394053 1 BBa_J23101 range2394053 1 1 35 annotation2394059 1 BBa_B0034 range2394059 1 179 190 annotation2394055 1 BBa_B0034 range2394055 1 44 55 annotation2394061 1 BBa_K592100 range2394061 1 197 901 annotation2394062 1 BBa_J61048 range2394062 1 910 1022 annotation2394057 1 BBa_K1415005 range2394057 1 62 170 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J61048 1 BBa_J61048 [rnpB-T1] Terminator 2007-02-20T12:00:00Z 2015-08-31T02:03:00Z bob bob false false _95_ 0 483 95 In stock false bob true John Anderson BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K592100 1 BFP Blue Fluorescent Protein (mTagBFP) 2011-09-19T11:00:00Z 2016-01-25T04:45:27Z Subach, O. M., I. S. Gundorov, et al. (2008). "Conversion of red fluorescent protein into a bright blue probe." Chem Biol 15(10): 1116-24. Released HQ 2013 This part codes for the bright blue fluorescent protein mTagBFP. mTagBFP is a monomeric protein with a narrow fluorescence emission spectrum with a maximum at 456 nm. It has a tyrosine-based chromophore, giving it substantially higher brightness, faster chromophore maturation and higher pH stability than blue fluorescent proteins with a histidine in the chromophore. Subach et. al. started with a red fluorescent protein (TagRed) and converted it to a bright blue monomeric protein. See the article listed in source. The sequence has been codon optimized for expression in E coli by DNA 2.0. false false _763_ 4206 10137 9 In stock true The sequence has been codon optimized for expression in E coli by DNA 2.0. false Erik Gullberg annotation2135490 1 mTagBFP range2135490 1 1 699 BBa_K1415005 1 BBa_K1415005 PBAN (Spodoptera litura) 2014-10-02T11:00:00Z 2015-05-08T01:10:19Z Artificial synthesis Oriental Leafworm Moth (Spodoptera litura) Spread:It is found in the Indo-Australian tropics. It is also established on most Polynesian islands where it occurs in a variety of island forms. Characteristics: Adult moths measure between 15-20 mm (0.59-0.79 inches) in length and have a wingspan of 30-38 mm (1.18-1.5 inches). Forewings are gray to reddish-brown, with a complex pattern of creamy streaks and paler lines along the veins. Hind wings are grayish-white with grayish-brown margins. Males have a blue-grey band from the upper corner (apex) to the inner margin of each forewing. Larvae have bright yellow stripes along the back and the sides. Larval color varies from pale green to dark green, Damage: Oriental Leafworm Moth Spodoptera litura is a Noctuid moth which is considered as an agricultural pest. It is also known as the Cluster caterpillar, Cotton leafworm, Tobacco cutworm, and Tropical armyworm. It has a very wide host range of over 120 plant species, including: lettuce, cabbage, beetroot, peanuts, geranium, cotton, banana, fuchsias, acacia, African oil palm, amaranth, alfalfa, strawberry, sorghum, sugarcane, tomatoes, asparagus, apple, eggplant, beet, beans, broccoli, elephants ear, horsetail she oak, corn, flax, lantana, papaya, orange, mango, leek, among many others. Control: The use of Bacillus thuringiensis (BT) may effectively control this pest. Other forms of biological, horticultural, and cultural control that have been studied include: planting near derris and garlic plants, breeding resistant plants from wild plants for example groundnuts from wild groundnuts, breeding resistant plants using bacterium Bacillus thuringiensis genes, using a Baculovirus, using the nematode Steinernema carpocapsae, and using the fly Exorista japonica. false false _1793_ 0 22512 9 In stock true No false HO, TSUNG YU annotation2392677 1 PBAN (Spodoptera litura) range2392677 1 1 109 BBa_B0034_sequence 1 aaagaggagaaa BBa_J61048_sequence 1 ccggcttatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtccacgacgctatacccaaaagaaa BBa_K1415005_sequence 1 atgctggcggacgatatgccggcgaccccggccgatcaggaactgtaccgtccagacccggatcaaatcgacagccgtaccaaatatttttctccacgcctgtaataat BBa_K1415205_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatgctggcggacgatatgccggcgaccccggccgatcaggaactgtaccgtccagacccggatcaaatcgacagccgtaccaaatatttttctccacgcctgtaataattactagagaaagaggagaaatactagatgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaattaataatactagagccggcttatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtccacgacgctatacccaaaagaaa BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_K592100_sequence 1 atgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z