BBa_K592100 1 BFP Blue Fluorescent Protein (mTagBFP) 2011-09-19T11:00:00Z 2016-01-25T04:45:27Z Subach, O. M., I. S. Gundorov, et al. (2008). "Conversion of red fluorescent protein into a bright blue probe." Chem Biol 15(10): 1116-24. Released HQ 2013 This part codes for the bright blue fluorescent protein mTagBFP. mTagBFP is a monomeric protein with a narrow fluorescence emission spectrum with a maximum at 456 nm. It has a tyrosine-based chromophore, giving it substantially higher brightness, faster chromophore maturation and higher pH stability than blue fluorescent proteins with a histidine in the chromophore. Subach et. al. started with a red fluorescent protein (TagRed) and converted it to a bright blue monomeric protein. See the article listed in source. The sequence has been codon optimized for expression in E coli by DNA 2.0. false false _763_ 4206 10137 9 In stock true The sequence has been codon optimized for expression in E coli by DNA 2.0. false Erik Gullberg annotation2135490 1 mTagBFP range2135490 1 1 699 BBa_K1415009 1 BBa_K1415009 PBAN (Aedes aegypti) 2014-10-02T11:00:00Z 2015-05-08T01:10:19Z Artificial synthesis Yellow fever mosquito (Aedes aegypyi) Spread:The yellow fever mosquito, Aedes aegypti, is a mosquito that can spread the dengue fever, chikungunya, and yellow fever viruses, and other diseases. The mosquito can be recognized by white markings on its legs and a marking in the form of a lyre on the thorax. The mosquito originated in Africa, but is now found in tropical and subtropical regions throughout the world. Characteristics: The mosquito can be recognized by white markings on its legs and a marking in the form of a lyre on the thorax. Damage: The yellow fever mosquito, Aedes aegypti, is a mosquito that can spread the dengue fever, chikungunya, and yellow fever viruses, and other diseases. Control:(1) Empty water from containers such as flower pots, birdbaths, pet water dishes, cans, gutters, tires and buckets regularly to disrupt the mosquito breeding cycle. (2)Consider using an insect repellent, be sure to follow the label directions for applying the repellent. For help selecting a mosquito repellent, try our Insect Repellent Locator. false false _1793_ 0 22512 9 In stock false No false HO, TSUNG YU annotation2392811 1 PBAN (Aedes aegypti) range2392811 1 1 64 BBa_J61048 1 BBa_J61048 [rnpB-T1] Terminator 2007-02-20T12:00:00Z 2015-08-31T02:03:00Z bob bob false false _95_ 0 483 95 In stock false bob true John Anderson BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1415209 1 BBa_K1415209 Pcons+B0034+PBAN(Aedes aegypti)+B0034+BFP+J61048 2014-10-04T11:00:00Z 2015-05-08T01:10:20Z Assemble We use this part as reporter gene, it can check whether our PBAN works and quantify its expression. false false _1793_ 0 22512 9 It's complicated false No false HO, TSUNG YU component2394101 1 BBa_K1415009 component2394106 1 BBa_J61048 component2394103 1 BBa_B0034 component2394099 1 BBa_B0034 component2394105 1 BBa_K592100 component2394097 1 BBa_J23101 annotation2394103 1 BBa_B0034 range2394103 1 134 145 annotation2394101 1 BBa_K1415009 range2394101 1 62 125 annotation2394099 1 BBa_B0034 range2394099 1 44 55 annotation2394105 1 BBa_K592100 range2394105 1 152 856 annotation2394097 1 BBa_J23101 range2394097 1 1 35 annotation2394106 1 BBa_J61048 range2394106 1 865 977 BBa_B0034_sequence 1 aaagaggagaaa BBa_J61048_sequence 1 ccggcttatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtccacgacgctatacccaaaagaaa BBa_K1415209_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagatggacgcgagcagtagcaacgaaaataacagccgcccgccgtttgccccgcgtctgtaataattactagagaaagaggagaaatactagatgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaattaataatactagagccggcttatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtccacgacgctatacccaaaagaaa BBa_K1415009_sequence 1 atggacgcgagcagtagcaacgaaaataacagccgcccgccgtttgccccgcgtctgtaataat BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_K592100_sequence 1 atgagcgaactgatcaaagagaacatgcacatgaagctgtacatggaaggcaccgttgacaaccaccactttaagtgcacgtctgagggtgagggtaagccgtacgaaggcacccaaaccatgcgtatcaaagttgtggagggcggtccactgccgttcgcttttgacattctggcgaccagcttcctgtacggttccaaaacgttcattaaccatactcagggcattccggatttcttcaaacagagctttccggaaggtttcacctgggagcgtgtcaccacgtatgaagatggtggtgtgttgaccgccacccaagatacctccctgcaagatggctgtctgatctataacgtgaaaattcgtggcgtcaactttacgagcaatggtccggtgatgcagaagaaaaccctgggttgggaggcgtttacggaaaccctgtatccggccgatggtggcctggagggccgtaacgacatggcactgaagctggttggtggcagccatttgatcgcaaatatcaagacgacgtaccgcagcaagaaaccggcgaaaaatctgaagatgccgggtgtttactatgtcgactaccgtctggaacgcattaaagaagcgaataatgagacttacgtggagcagcacgaggttgcagtcgcgcgctattgcgacttgcctagcaagctgggtcataaactgaattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z