BBa_K1417001 1 BBa_K1417001 Spacer 2014-10-08T11:00:00Z 2015-05-08T01:10:21Z Synthetic This is a spacer used to separate elements in combinatory RNA false false _1795_ 0 22701 9 Not in stock false The spacer has to be of sufficient length that the two RNA pieces do not interfere with each other and does not have any secondary structure. false Adam Baker BBa_K1417001_sequence 1 gcccggatagctcagtcggtagagcagcggccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z