BBa_K1419003 1 BBa_K1419003 Universal riboregulatable RBS 2014-10-08T11:00:00Z 2015-05-08T01:10:21Z Bacterial plasmid origin. S32 RNA-OUT component for a universal RNA-IN/OUT regulation system that does not require base pairing to the downstream gene. false false _1797_ 0 6050 9 It's complicated false Needed to alter the natural RNA-OUT design to allow for base pairing to the RBS. false Harland Brandon BBa_K1419003_sequence 1 cgcttaaatcaaagaggagaaaataatcatgaccggtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z