BBa_K1420005 1 BBa_K1420005 merT, mercuric transport protein 2014-10-08T11:00:00Z 2015-07-22T03:01:03Z Source organism: Serratia marcescens. Amplified from plasmid pDU1358, kindly donated by Anne O. Summers. merT is found in the Serratia marcescens plasmid pDU1358 on the other side of the bidirectional promoter opposite of merR. It is 351 base pairs long and is hypothesized that it codes for a mercuric transport protein. false false _1798_ 4206 17872 9 In stock false N/A false Stephen C. Heinsch annotation2407640 1 merT range2407640 1 1 351 BBa_K1420005_sequence 1 atgtctgaacctcaaaacgggcgcggggcgctcttcactggcgggctagccgccatcctcgcctcggcttgctgcctggggccgctggttctgatcgccctggggttcagcggcgcttggatcggcaacttgacggtgttggaaccttatcgcccgatcttcatcggcgcggcgttggtggcgctgtttttcgcctggcggcgcatctaccgaccggcgcaagcctgcaaaccaggggatgtgtgtgcgattccccaagtgcgcgctacttacaagctcattttctgggtcgtggccgcgctggttctggtcgcgctcggatttccctacgtcatgccatttttctattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z