BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K142009 1 BBa_K142009 lacI IS mutant R197F with RBS and terminator 2008-10-28T12:00:00Z 2015-05-08T01:10:22Z The lacI IS mutant presented derive from the BioBrick I763026, which as it turned out during sequencing by the Caltech team, did not have a promotor. Site-directed mutagenesis was performed by PCR, subsequent DpnI digest and transformation. The following primers were used for mutagenesis: R197F forward CGGCGCGTCTGTTTCTGGCTGGCTG R197A forward CGGCGCGTCTGGCGCTGGCTGGCTG R197F reverse CAGCCAGCCAGAAACAGACGCGCCG R197A reverse CAGCCAGCCAGCGCCAGACGCGCCG T276F forward GGATACGACGATTTTGAAGACAGCTC T276A forward GGATACGACGATGCGGAAGACAGCTC T276F reverse GAGCTGTCTTCAAAATCGTCGTATCC T276A reverse GAGCTGTCTTCCGCATCGTCGTATCC ==lacI IS mutant (IPTG unresponsive) with ribosome binding site and terminator== ?????????Short description:????????? The lacI IS mutant is almost identical to the lacI transcriptional regulator except for the difference that it is not able to bind IPTG or allolactose due to a mutation; it therefore can not be activated by induction with these substances. Since it recognizes the same motif in the lac promotor region, it strongly represses transcription of all genes regulated by promotors with lacI binding site even if IPTG or allolactose are present. It can be used to terminate the expression of proteins under lac control if IPTG can not be removed from the cell rapidly. ?????????Detailed description:????????? Expression of the lac operon in E. coli is tightly controlled by lacI, a protein, which binds to a repressor binding site within the promotor and disables transcription by obscuring the promotor region. When bound to DNA, lacI is in the tetrameric form, which consists of two dimers interacting at the end distal from the DNA binding site. Upon binding of allolactose or IPTG, the tetramer breaks down into two dimers and the affinity for the repressor binding site is greatly reduced; the lacI IPTG complex will diffuse away from the repressor binding site, leaving the promotor accessible. As a result of decades of genetic and structural studies, the function of lacI is now understood on the molecular level (1, 2). Mutational experiments have identified residues, which abolish IPTG response upon mutation (3). Furthermore, the x-ray crystal structure of lacI with bound IPTG has allowed the identification of residues that interact with IPTG and which are promising targets for mutagenesis (1). We decided to mutate residues R197 and T276, which are located in the IPTG binding groove, contact IPTG and have been shown to produce the lacI IS mutation in previous genetic experiments. Since a quantitative study of the strength of inhibition by different lacI IS mutants has to our knowledge not been published so far, we decided to generate a set of eight mutated lacIs, in which we replaced either R197 with alanine or phenylalanine or T276 with alanine or phenylalanine or both in all possible combinations. lacIIS-1: R197A lacIIS-2: R197F lacIIS-3: T276A lacIIS-4: T276F lacIIS-5: R197A T276A lacIIS-6: R197A T276F lacIIS-7: R197F T276A lacIIS-8: R197F T276F This BioBrick is based on BioBrick I763026 and contains a ribosome binding site, the lacI IS gene and a double terminator. As sequencing by Caltech has shown that BioBrick I763026 did not have a promotor this BioBrick is promotorless, too. Expression of the mutant LacI IS (and silencing of lac-controlled gene expression) can therefore be controlled by any promotor of choice if this BioBrick is cloned behind it. References: (1) Lewis, M., Chang, G., Horton, N. C., Kercher, M. A., Pace, H. C., Schumacher, M. A., Brennan, R. G., and Lu, P. (1996) Crystal structure of the lactose operon repressor and its complexes with DNA and inducer. Science 271, 1247-54. (2) Friedman, A. M., Fischmann, T. O., and Steitz, T. A. (1995) Crystal structure of lac repressor core tetramer and its implications for DNA looping. Science 268, 1721-7. (3) Suckow, J., Markiewicz, P., Kleina, L. G., Miller, J., Kisters-Woike, B., and Muller-Hill, B. (1996) Genetic studies of the Lac repressor. XV: 4000 single amino acid substitutions and analysis of the resulting phenotypes on the basis of the protein structure. J Mol Biol 261, 509-23. false false _194_ 0 3254 9 It's complicated false During site-directed mutagenesis, the codons to be mutated were replaced with the most highly utilized codons in E. coli to prevent complications from the use of rare codons. The lacI IS sequences were analyzed for BioBrick restriction sites within the coding sequence to ensure their compatibility. false Julius Rabl component1993718 1 BBa_B0034 component1993721 1 BBa_K142001 component1993722 1 BBa_B0010 component1993724 1 BBa_B0012 annotation1993722 1 BBa_B0010 range1993722 1 1155 1234 annotation1993724 1 BBa_B0012 range1993724 1 1243 1283 annotation1993721 1 BBa_K142001 range1993721 1 19 1146 annotation1993718 1 BBa_B0034 range1993718 1 1 12 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K142001 1 BBa_K142001 lacI IS mutant (IPTG unresponsive) R197F 2008-10-16T11:00:00Z 2015-05-08T01:10:22Z The lacI IS mutants presented derive from the BioBrick holding lacI by itself (C0012). Site-directed mutagenesis was performed by PCR, subsequent DpnI digest and transformation. The following primers were used: R197F forward CGGCGCGTCTGTTTCTGGCTGGCTG R197A forward CGGCGCGTCTGGCGCTGGCTGGCTG R197F reverse CAGCCAGCCAGAAACAGACGCGCCG R197A reverse CAGCCAGCCAGCGCCAGACGCGCCG T276F forward GGATACGACGATTTTGAAGACAGCTC T276A forward GGATACGACGATGCGGAAGACAGCTC T276F reverse GAGCTGTCTTCAAAATCGTCGTATCC T276A reverse GAGCTGTCTTCCGCATCGTCGTATCC All lacI IS holding BioBricks were verified by sequencing. Short description: The lacI IS mutant is almost identical to the lacI transcriptional regulator except for the difference that it is not able to bind IPTG or allolactose due to a mutation; it therefore can not be activated by induction with these substances. Since it recognizes the same motif in the lac promotor region, it strongly represses transcription of all genes regulated by promotors with lacI binding site even if IPTG or allolactose are present. It can be used to terminate the expression of proteins under lac control if IPTG can not be removed from the cell rapidly. Detailed description: Expression of the lac operon in E. coli is tightly controlled by lacI, a protein, which binds to a repressor binding site within the promotor and disables transcription by obscuring the promotor region. When bound to DNA, lacI is in the tetrameric form, which consists of two dimers interacting at the end distal from the DNA binding site. Upon binding of allolactose or IPTG, the tetramer breaks down into two dimers and the affinity for the repressor binding site is greatly reduced; the lacI IPTG complex will diffuse away from the repressor binding site, leaving the promotor accessible. As a result of decades of genetic and structural studies, the function of lacI is now understood on the molecular level (1, 2). Mutational experiments have identified residues, which abolish IPTG response upon mutation (3). Furthermore, the x-ray crystal structure of lacI with bound IPTG has allowed the identification of residues that interact with IPTG and which are promising targets for mutagenesis (1). We decided to mutate residues R197 and T276, which are located in the IPTG binding groove, contact IPTG and have been shown to produce the lacI IS mutation in previous genetic experiments. Since a quantitative study of the strength of inhibition by different lacI IS mutants has to our knowledge not been published so far, we decided to generate a set of eight mutated lacIs, in which we replaced either R197 with alanine or phenylalanine or T276 with alanine or phenylalanine or both in all possible combinations. lacIIS-1: R197A lacIIS-2: R197F lacIIS-3: T276A lacIIS-4: T276F lacIIS-5: R197A T276A lacIIS-6: R197A T276F lacIIS-7: R197F T276A lacIIS-8: R197F T276F References: (1) Lewis, M., Chang, G., Horton, N. C., Kercher, M. A., Pace, H. C., Schumacher, M. A., Brennan, R. G., and Lu, P. (1996) Crystal structure of the lactose operon repressor and its complexes with DNA and inducer. Science 271, 1247-54. (2) Friedman, A. M., Fischmann, T. O., and Steitz, T. A. (1995) Crystal structure of lac repressor core tetramer and its implications for DNA looping. Science 268, 1721-7. (3) Suckow, J., Markiewicz, P., Kleina, L. G., Miller, J., Kisters-Woike, B., and Muller-Hill, B. (1996) Genetic studies of the Lac repressor. XV: 4000 single amino acid substitutions and analysis of the resulting phenotypes on the basis of the protein structure. J Mol Biol 261, 509-23. false false _194_ 0 3254 9 It's complicated false During site-directed mutagenesis, the codons to be mutated were replaced with the most highly utilized codons in E. coli to prevent complications from the use of rare codons. The lacI IS sequences were analyzed for BioBrick restriction sites within the coding sequence to ensure their compatibility. false Julius Rabl annotation1981800 1 R197F range1981800 1 598 600 annotation1981799 1 lacI IS range1981799 1 1 1128 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K142009_sequence 1 aaagaggagaaatactagatggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgtttctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K142001_sequence 1 atggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgtttctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z