BBa_J23105 1 BBa_J23105 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K142006 1 BBa_K142006 lacI IS mutant (IPTG unresponsive) R197F T276A 2008-10-24T11:00:00Z 2015-05-08T01:10:22Z The lacI IS mutants presented derive from the BioBrick holding lacI by itself (C0012). Site-directed mutagenesis was performed by PCR, subsequent DpnI digest and transformation. The following primers were used: R197F forward CGGCGCGTCTGTTTCTGGCTGGCTG R197A forward CGGCGCGTCTGGCGCTGGCTGGCTG R197F reverse CAGCCAGCCAGAAACAGACGCGCCG R197A reverse CAGCCAGCCAGCGCCAGACGCGCCG T276F forward GGATACGACGATTTTGAAGACAGCTC T276A forward GGATACGACGATGCGGAAGACAGCTC T276F reverse GAGCTGTCTTCAAAATCGTCGTATCC T276A reverse GAGCTGTCTTCCGCATCGTCGTATCC All lacI IS holding BioBricks were verified by sequencing. lacI IS mutant (IPTG unresponsive) Short description: The lacI IS mutant is almost identical to the lacI transcriptional regulator except for the difference that it is not able to bind IPTG or allolactose due to a mutation; it therefore can not be activated by induction with these substances. Since it recognizes the same motif in the lac promotor region, it strongly represses transcription of all genes regulated by promotors with lacI binding site even if IPTG or allolactose are present. It can be used to terminate the expression of proteins under lac control if IPTG can not be removed from the cell rapidly. Detailed description: Expression of the lac operon in E. coli is tightly controlled by lacI, a protein, which binds to a repressor binding site within the promotor and disables transcription by obscuring the promotor region. When bound to DNA, lacI is in the tetrameric form, which consists of two dimers interacting at the end distal from the DNA binding site. Upon binding of allolactose or IPTG, the tetramer breaks down into two dimers and the affinity for the repressor binding site is greatly reduced; the lacI IPTG complex will diffuse away from the repressor binding site, leaving the promotor accessible. As a result of decades of genetic and structural studies, the function of lacI is now understood on the molecular level (1, 2). Mutational experiments have identified residues, which abolish IPTG response upon mutation (3). Furthermore, the x-ray crystal structure of lacI with bound IPTG has allowed the identification of residues that interact with IPTG and which are promising targets for mutagenesis (1). We decided to mutate residues R197 and T276, which are located in the IPTG binding groove, contact IPTG and have been shown to produce the lacI IS mutation in previous genetic experiments. Since a quantitative study of the strength of inhibition by different lacI IS mutants has to our knowledge not been published so far, we decided to generate a set of eight mutated lacIs, in which we replaced either R197 with alanine or phenylalanine or T276 with alanine or phenylalanine or both in all possible combinations. lacIIS-1: R197A lacIIS-2: R197F lacIIS-3: T276A lacIIS-4: T276F lacIIS-5: R197A T276A lacIIS-6: R197A T276F lacIIS-7: R197F T276A lacIIS-8: R197F T276F References: (1) Lewis, M., Chang, G., Horton, N. C., Kercher, M. A., Pace, H. C., Schumacher, M. A., Brennan, R. G., and Lu, P. (1996) Crystal structure of the lactose operon repressor and its complexes with DNA and inducer. Science 271, 1247-54. (2) Friedman, A. M., Fischmann, T. O., and Steitz, T. A. (1995) Crystal structure of lac repressor core tetramer and its implications for DNA looping. Science 268, 1721-7. (3) Suckow, J., Markiewicz, P., Kleina, L. G., Miller, J., Kisters-Woike, B., and Muller-Hill, B. (1996) Genetic studies of the Lac repressor. XV: 4000 single amino acid substitutions and analysis of the resulting phenotypes on the basis of the protein structure. J Mol Biol 261, 509-23. false false _194_ 0 3254 9 It's complicated false During site-directed mutagenesis, the codons to be mutated were replaced with the most highly utilized codons in E. coli to prevent complications from the use of rare codons. The lacI IS sequences were analyzed for BioBrick restriction sites within the coding sequence to ensure their compatibility. false Julius Rabl annotation1987411 1 lacI IS range1987411 1 1 1128 BBa_K142030 1 BBa_K142030 IPTG-on tetracycline-off pulse generator with LacI mutant (R197F, T276A)/TetR expression cassette 2008-10-28T12:00:00Z 2015-05-08T01:10:22Z The pulse generator precursor has been assembled from tetracycline-controlled lacI generator [http://partsregistry.org/wiki/index.php?title=Part:BBa_K142046 K142046] and the constitutive TetR expression cassette [http://partsregistry.org/Part:BBa_I739001 I739001] using standard cloning techniques. The lacI IS mutant presented derives from site-directed mutagenesis, which was performed on the precursor [http://partsregistry.org/wiki/index.php?title=Part:BBa_K142047 K142047] by PCR, subsequent DpnI digest and transformation. The following primers were used for mutagenesis: R197F forward CGGCGCGTCTGTTTCTGGCTGGCTG R197A forward CGGCGCGTCTGGCGCTGGCTGGCTG R197F reverse CAGCCAGCCAGAAACAGACGCGCCG R197A reverse CAGCCAGCCAGCGCCAGACGCGCCG T276F forward GGATACGACGATTTTGAAGACAGCTC T276A forward GGATACGACGATGCGGAAGACAGCTC T276F reverse GAGCTGTCTTCAAAATCGTCGTATCC T276A reverse GAGCTGTCTTCCGCATCGTCGTATCC ==IPTG-on/tetracycline-off switch circuit== ===Short description:=== This part contains a tetracycline-controlled LacI IS expression cassette followed by a constitutive TetR expression cassette. The LacI IS mutant is almost identical to the LacI transcriptional regulator except for the difference that it is not able to bind IPTG or allolactose due to a mutation; it therefore can not be activated by induction with these substances. Since it recognizes the same motif in the lac promotor region, it strongly represses transcription of all genes regulated by promotors with lacI binding site even if IPTG or allolactose are present. It is used to terminate the expression of proteins under lac control if IPTG can not be removed from the cell rapidly. ===Detailed description:=== ====LacI IS mutants are uninducible repressors of lac-controlled promotors==== Expression of the lac operon in E. coli is tightly controlled by LacI, a protein, which binds to a repressor binding site within the promotor and disables transcription by obscuring the promotor region. When bound to DNA, LacI is in the tetrameric form, which consists of two dimers interacting at the end distal from the DNA binding site. Upon binding of allolactose or IPTG, the tetramer breaks down into two dimers and the affinity for the repressor binding site is greatly reduced; the lacI IPTG complex will diffuse away from the repressor binding site, leaving the promotor accessible. As a result of decades of genetic and structural studies, the function of lacI is now understood on the molecular level (1, 2). Mutational experiments have identified residues, which abolish IPTG response upon mutation (3). Furthermore, the x-ray crystal structure of LacI with bound IPTG has allowed the identification of residues that interact with IPTG and which are promising targets for mutagenesis (1). [[image:jr_pulsegen_1.jpg|frame|none| A LacI repressor tetramer, residues R197 and T276 are shown in red. B IPTG bound to the inducer binding site of the lac repressor, residues R197 and T276 are shown in green. Molecular graphics was generated from coordinate set [http://www.rcsb.org/pdb/explore.do?structureId=1LBH 1lbh] (1) using [http://www.cgl.ucsf.edu/chimera/ UCSF Chimera].]] We decided to mutate residues R197 and T276, which are located in the IPTG binding groove, contact IPTG and have been shown to produce the lacI IS mutation in previous genetic experiments. We decided to generate a set of eight mutated lacIs, in which we replaced either R197 with alanine or phenylalanine or T276 with alanine or phenylalanine or both in all possible combinations. lacIIS-1: R197A lacIIS-2: R197F lacIIS-3: T276A lacIIS-4: T276F lacIIS-5: R197A T276A lacIIS-6: R197A T276F lacIIS-7: R197F T276A lacIIS-8: R197F T276F All mutants appeared to be equally efficient in preliminary genetic experiments with full repression even at elevated concentrations of 10mM IPTG. Please see the chapter on the switch circuit in the [http://2008.igem.org/Team:ETH_Zurich/Wetlab/Switch_Circuit ETH 2008 Wiki] for details. ====Purpose of this BioBrick==== This BioBrick allows pulsing of protein expression under lac-controlled promotors. It is especially useful if change of medium to remove the inducer is not an option (such as inside a fermenter/chemostat). Since the signal for stop of expression is independent from the induction of expression, pulses of different duration can be tested without any modification of the pulse generator construct. ===References:=== (1) Lewis, M., Chang, G., Horton, N. C., Kercher, M. A., Pace, H. C., Schumacher, M. A., Brennan, R. G., and Lu, P. (1996) Crystal structure of the lactose operon repressor and its complexes with DNA and inducer. Science 271, 1247-54. (2) Friedman, A. M., Fischmann, T. O., and Steitz, T. A. (1995) Crystal structure of lac repressor core tetramer and its implications for DNA looping. Science 268, 1721-7. (3) Suckow, J., Markiewicz, P., Kleina, L. G., Miller, J., Kisters-Woike, B., and Muller-Hill, B. (1996) Genetic studies of the Lac repressor. XV: 4000 single amino acid substitutions and analysis of the resulting phenotypes on the basis of the protein structure. J Mol Biol 261, 509-23. false false _194_ 0 3254 9 Not in stock false During site-directed mutagenesis, the codons to be mutated were replaced with the most highly utilized codons in E. coli to prevent complications from the use of rare codons. The lacI IS sequences were analyzed for BioBrick restriction sites within the coding sequence to ensure their compatibility. false Julius Rabl component2282912 1 BBa_I739001 component2282897 1 BBa_K142022 annotation2282897 1 BBa_K142022 range2282897 1 1 1345 annotation2282912 1 BBa_I739001 range2282912 1 1354 2236 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I739001 1 BBa_I739001 Constitutive expression cassette for TetR +LVA (J23100.B0034.C0040.B0015) 2007-09-26T11:00:00Z 2015-08-31T04:08:01Z synthetic DNA The Biobrick encodes tetR (BBa_C0040) under control of the constitutive promoter (BBa_J23100) followed by the ribosome binding site BBa_B0034. The transcription of tetR is terminated by the double terminator BBa_B0015 false false _124_ 0 2208 9 In stock false expression cassette for tetR true Christian Kemmer, Stefan Luzi component2253166 1 BBa_C0040 component2253162 1 BBa_B0034 component2253160 1 BBa_J23105 component2253173 1 BBa_B0015 annotation2253166 1 BBa_C0040 range2253166 1 62 746 annotation2253173 1 BBa_B0015 range2253173 1 755 883 annotation2253160 1 BBa_J23105 range2253160 1 1 35 annotation2253162 1 BBa_B0034 range2253162 1 44 55 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K142022 1 BBa_K142022 tet-controlled lacI IS mutant (R197F, T276A) generator 2008-10-28T12:00:00Z 2015-05-08T01:10:22Z The lacI IS mutant presented derives from the BioBrick [http://partsregistry.org/wiki/index.php?title=Part:BBa_K142046 K142046]. Site-directed mutagenesis was performed by PCR, subsequent DpnI digest and transformation. The following primers were used for mutagenesis: R197F forward CGGCGCGTCTGTTTCTGGCTGGCTG R197A forward CGGCGCGTCTGGCGCTGGCTGGCTG R197F reverse CAGCCAGCCAGAAACAGACGCGCCG R197A reverse CAGCCAGCCAGCGCCAGACGCGCCG T276F forward GGATACGACGATTTTGAAGACAGCTC T276A forward GGATACGACGATGCGGAAGACAGCTC T276F reverse GAGCTGTCTTCAAAATCGTCGTATCC T276A reverse GAGCTGTCTTCCGCATCGTCGTATCC ==tet-controlled lacI IS generator== ===Short description:=== The lacI IS mutant is almost identical to the lacI transcriptional regulator except for the difference that it is not able to bind IPTG or allolactose due to a mutation; it therefore can not be activated by induction with these substances. Since it recognizes the same motif in the lac promotor region, it strongly represses transcription of all genes regulated by promotors with lacI binding site even if IPTG or allolactose are present. It can be used to terminate the expression of proteins under lac control if IPTG can not be removed from the cell rapidly. ===Detailed description:=== ====LacI IS mutants are uninducible repressors of lac-controlled promotors==== Expression of the lac operon in E. coli is tightly controlled by lacI, a protein, which binds to a repressor binding site within the promotor and disables transcription by obscuring the promotor region. When bound to DNA, lacI is in the tetrameric form, which consists of two dimers interacting at the end distal from the DNA binding site. Upon binding of allolactose or IPTG, the tetramer breaks down into two dimers and the affinity for the repressor binding site is greatly reduced; the lacI IPTG complex will diffuse away from the repressor binding site, leaving the promotor accessible. As a result of decades of genetic and structural studies, the function of lacI is now understood on the molecular level (1, 2). Mutational experiments have identified residues, which abolish IPTG response upon mutation (3). Furthermore, the x-ray crystal structure of lacI with bound IPTG has allowed the identification of residues that interact with IPTG and which are promising targets for mutagenesis (1). [[image:jr_pulsegen_1.jpg|frame|none| Figure 3: A Lac repressor tetramer, residues R197 and T276 are shown in red. B IPTG bound to the inducer binding site of the lac repressor, residues R197 and T276 are shown in green. Molecular graphics was generated from coordinate set [http://www.rcsb.org/pdb/explore.do?structureId=1LBH 1lbh] (1) using [http://www.cgl.ucsf.edu/chimera/ UCSF Chimera].]] We decided to mutate residues R197 and T276, which are located in the IPTG binding groove, contact IPTG and have been shown to produce the lacI IS mutation in previous genetic experiments. Since a quantitative study of the strength of inhibition by different lacI IS mutants has to our knowledge not been published so far, we decided to generate a set of eight mutated lacIs, in which we replaced either R197 with alanine or phenylalanine or T276 with alanine or phenylalanine or both in all possible combinations. lacIIS-1: R197A lacIIS-2: R197F lacIIS-3: T276A lacIIS-4: T276F lacIIS-5: R197A T276A lacIIS-6: R197A T276F lacIIS-7: R197F T276A lacIIS-8: R197F T276F ====Purpose of this BioBrick==== This BioBrick is based on BioBrick [http://partsregistry.org/Part:BBa_I763026 I763026] in the original form. As sequencing by Caltech has shown that BioBrick [http://partsregistry.org/Part:BBa_I763026 I763026] did not have a promotor, we have added tetracycline-inducible promotor [http://partsregistry.org/Part:BBa_R0040 R0040] to the Biobrick before subjecting it to site-directed mutagenesis. Expression of the mutant LacI IS (and silencing of lac-controlled gene expression) can therefore be initiated by addition of inducer tetracycline. Please not that E. coli does not produce the tet-repressor protein tetR! This generator will be constitutively active unless you introduce a TetR expression cassette into your system (like e.g. [http://partsregistry.org/Part:BBa_I739001 I739001]) ===References:=== (1) Lewis, M., Chang, G., Horton, N. C., Kercher, M. A., Pace, H. C., Schumacher, M. A., Brennan, R. G., and Lu, P. (1996) Crystal structure of the lactose operon repressor and its complexes with DNA and inducer. Science 271, 1247-54. (2) Friedman, A. M., Fischmann, T. O., and Steitz, T. A. (1995) Crystal structure of lac repressor core tetramer and its implications for DNA looping. Science 268, 1721-7. (3) Suckow, J., Markiewicz, P., Kleina, L. G., Miller, J., Kisters-Woike, B., and Muller-Hill, B. (1996) Genetic studies of the Lac repressor. XV: 4000 single amino acid substitutions and analysis of the resulting phenotypes on the basis of the protein structure. J Mol Biol 261, 509-23. false false _194_ 0 3254 9 Not in stock false During site-directed mutagenesis, the codons to be mutated were replaced with the most highly utilized codons in E. coli to prevent complications from the use of rare codons. The lacI IS sequences were analyzed for BioBrick restriction sites within the coding sequence to ensure their compatibility. false Julius Rabl component1994169 1 BBa_R0040 component1994175 1 BBa_B0034 component1994177 1 BBa_K142006 component1994180 1 BBa_B0012 component1994178 1 BBa_B0010 annotation1994178 1 BBa_B0010 range1994178 1 1217 1296 annotation1994175 1 BBa_B0034 range1994175 1 63 74 annotation1994177 1 BBa_K142006 range1994177 1 81 1208 annotation1994169 1 BBa_R0040 range1994169 1 1 54 annotation1994180 1 BBa_B0012 range1994180 1 1305 1345 BBa_C0040 1 tetR tetracycline repressor from transposon Tn10 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999) Released HQ 2013 Coding region for the TetR protein without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. TetR binds to the pTet regulator (BBa_R0040). aTc (anhydrotetracycline) binds to TetR and inhibits its operation.</P> false true _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P> References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P>BBa_C0040 TetR Protein is based on the TetR sequence from Elowitz's repressilator. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman. annotation23329 1 tetR range23329 1 4 620 annotation23330 1 SsrA range23330 1 621 654 annotation2213989 1 Help:Barcodes range2213989 1 661 685 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23105_sequence 1 tttacggctagctcagtcctaggtactatgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K142022_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgtttctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgatgcggaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K142030_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgtttctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgatgcggaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtttacggctagctcagtcctaggtactatgctagctactagagaaagaggagaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K142006_sequence 1 atggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgtttctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgatgcggaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataa BBa_I739001_sequence 1 tttacggctagctcagtcctaggtactatgctagctactagagaaagaggagaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_C0040_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z