BBa_K1421005 1 BBa_K1421005 pRPAI 2014-10-04T11:00:00Z 2015-05-08T01:10:22Z This part???s sequence comes from the genome of Rhodopseudomonas palustris, and we did two nucleotides??? modification to make it match the requirements of part and then synthesized it. In the photosynthetic bacterium Rhodopseudomonas palustris, there is a quorum-sensing system RPAI/RPAR, which is similar to the LUXI/LUXR system in V. Fischeri. RpaI is the acyl-HSL synthase to produce p-coumaroyl-HSL by using environmental p-coumaric acid. RPAR is a signal receptor with homology to fatty acyl-HSL receptors (such as LuxR) that responds to p-coumaroyl-HSL to regulate global gene expression including the promoter of RPAI, pRPAI.[1] In deed, there have already been numbers of quorum-sensing systems; usually, the signals of these systems are not unique and inter-influence the other. While, p-coumaroyl-HSL (pc-HSL), the signal of RPAI/RPAR system is unique to AHL. So, RPA system is independent on LUX system and a part of its homologies. This part, pRpaI, is the promoter of RPAI. It opens the expression of the gene behind and meanwhile, can be regulated by the complex RPAR/pc-HSL. Reference : [1] 3.quorum sensing system in Rhodopseudomonas palustris:Schaefer A L, Greenberg E P, Oliver C M, et al. A new class of homoserine lactone quorum-sensing signals[J]. Nature, 2008, 454(7204): 595-599. false false _1799_ 0 21107 9 It's complicated false This part???s sequence comes from the genome of Rhodopseudomonas palustris, and we did two nucleotides??? modification to make it match the requirements of partand then synthesized it. false Mengni Wang annotation2393911 1 lux box-like elements 1 range2393911 1 1 20 annotation2393912 1 lux box-like elements 2 range2393912 1 43 63 BBa_K1421005_sequence 1 acctgtccgatcggacagtagttaggttcccgttcgcacctgcactgttcccgcgtgcagacccagtgcaggaggggaatttcatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z