BBa_K1421007 1 BBa_K1421007 pRPAI+RPAI 2014-10-04T11:00:00Z 2015-05-08T01:10:22Z This part???s sequence comes from the genome of Rhodopseudomonas palustris and we did 5 nucleotides??? modification to make it match the requirements of part and then synthesized it. In the photosynthetic bacterium Rhodopseudomonas palustris, there is a quorum-sensing system RPAI/RPAR, which is similar to the LUXI/LUXR system in V. Fischeri. RpaI is the acyl-HSL synthase to produce p-coumaroyl-HSL by using environmental p-coumaric acid. RPAR is a signal receptor with homology to fatty acyl-HSL receptors (such as LuxR) that responds to p-coumaroyl-HSL to regulate global gene expression including the promoter of RPAI, pRPAI.[1] In deed, there have already been numbers of quorum-sensing systems; usually, the signals of these systems are not unique and inter-influence the other. While, p-coumaroyl-HSL (pc-HSL), the signal of RPAI/RPAR system is unique to AHL. So, RPA system is independent on LUX system and a part of its homologies. This part is comprised of promoter of RPAI and coding region of RPAI. To use this device, one should put 1mM p-coumarate in the plate and pc-HSL, the signal of RPA system, will be produced. Reference : [1] 3.quorum sensing system in Rhodopseudomonas palustris:Schaefer A L, Greenberg E P, Oliver C M, et al. A new class of homoserine lactone quorum-sensing signals[J]. Nature, 2008, 454(7204): 595-599. false false _1799_ 0 21107 9 It's complicated false This part???s sequence comes from the genome of Rhodopseudomonas palustris and we did 5 nucleotides??? modification to make it match the requirements of part and then synthesized it. false Mengni Wang BBa_K1421007_sequence 1 cctgtccgatcggacagtagttaggttcccgttcgcacctgcactgttcccgcgtgcagacccagtgcaggaggggaatttcatcatgcaggttcatgtcatccgtcgagagaaccgcgcgctctatgccggtctgctcgaaaagtacttccgcatccgtcaccagatctacgtcgtcgagcgcggctggaaggagctcgatcggccggatggccgcgagatcgatcagttcgacaccgaagacgccgtgtatctgctcggcgtcgacaatgacgacatcgtcgccggcatgcggatggtgccgaccacgtcaccgacgctcctcagcgacgtcttcccgcagcttgcgctggcaggcccggtgcggcggccggatgcctacgagctgtcgcggatcttcgtggtaccgcgcaagcgcggcgagcatggcggcccgcgcgccgaagccgtgatccaggccgccgcgatggagtacggcctgtcgatcggtctgtcggccttcaccatcgtgctggaaacctggtggctgccgcgactggtggaccagggctggaaggcaaagccgctcggcctgcctcaggacatcaacggattctcgaccaccgcagtgatcgtcgacgtcgacgacgacgcctgggtcggcatctgcaatcgccgctcggtgcccggacccacgctggaatggcgcgggctcgaagccatccgccgtcattcgcttccggagttccaggtgatttcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z