BBa_K1424002 1 BBa_K1424002 Lac promoter optimised for Synechocystis 2014-09-24T11:00:00Z 2015-05-08T01:10:23Z Synthesised sequence Lac promoter (BBa_R0010) with optimised -10 and RBS for Synechocystis sp. PCC 6803. Optimisation of this area had been shown to improve promotion and transcription of genes in Synechocystis sp. PCC 6803 by Huang and Lindblad (2013). false false _1802_ 0 20667 9 It's complicated false n/a false Jacob Lamb annotation2386322 1 Synechocystis optimisation range2386322 1 166 178 annotation2386324 1 RBS range2386324 1 206 215 annotation2386325 1 Lac Operator range2386325 1 178 199 BBa_K1424002_sequence 1 tagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtataatggacactattgtgagcggataacaatttcacacatagtggaggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z