BBa_K143001 1 amyE 5 IS 5??? Integration Sequence for the amyE locus of B. subtilis 2008-08-26T11:00:00Z 2015-05-08T01:10:23Z The 5??? integration sequence was taken from the shuttle vector pDR111 which has been used in many studies on ''B.subtilis'', in particular in the studies of transcriptional control<cite>#1 #2 #3</cite> <biblio> #1 pmid=14597697 #2 pmid=15937167 #3 pmid=12169614 </biblio> Released HQ 2013 The 5' integration sequence can be added to the front of a Biobrick construct and the 3' integration sequence specific for this locus (Part BBa_K143002) to the rear of the Biobrick construct to allow integration of the Biobrick construct into the chromosome of the gram positive bacterium B.subtilis. The AmyE locus was the first locus used for integration into ''B.subtilis'' by Shimotsu and Henner<cite>#1</cite> and is still commonly used in vectors such as pDR111<cite>#2</cite>, pDL<cite>#3</cite> and their derivatives. Integration at the AmyE locus removes the ability of ''B.subtilis'' to break down starch, which can be assayed with iodine as described by Cutting and Vander-horn<cite>#4</cite>. The 5' and 3' integration sequences for the AmyE locus were used to integrate the Imperial 2008 iGEM project primary construct into the ''B.sutbilis'' chromosome. <biblio> #1 pmid=3019840 #2 pmid=14597697 #3 ''Bacillus'' Genetic Stock Center [www.bgsc.org] #4 Cutting, S M.; Vander-Horn, P B. Genetic analysis. In: Harwood C R, Cutting S M. , editors. Molecular biological methods for Bacillus. Chichester, England: John Wiley & Sons, Ltd.; 1990. pp. 27???74. </biblio> false false _199_ 0 3475 9 In stock true The AmyE integration sequence was taken from the vector after comparison by BLAST to the ''B.subtilis'' chromosome to identify the homologous sequences. The sequence present in both the host chromosome and the plasmid at the 5' end of the gene is the 5' sequence required for integration. true Chris Hirst annotation1974145 1 5' AmyE homologous sequence range1974145 1 1 522 BBa_K143001_sequence 1 atgtttgcaaaacgattcaaaacctctttactgccgttattcgctggatttttattgctgtttcatttggttctggcaggaccggcggctgcgagtgctgaaacggcgaacaaatcgaatgagcttacagcaccgtcgatcaaaagcggaaccattcttcatgcatggaattggtcgttcaatacgttaaaacacaatatgaaggatattcatgatgcaggatatacagccattcagacatctccgattaaccaagtaaaggaagggaatcaaggagataaaagcatgtcgaactggtactggctgtatcagccgacatcgtatcaaattggcaaccgttacttaggtactgaacaagaatttaaagaaatgtgtgcagccgctgaagaatatggcataaaggtcattgttgacgcggtcatcaatcataccaccagtgattatgccgcgatttccaatgaggttaagagtattccaaactggacacatggaaacacacaaattaaaaactggtctgatcga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z