BBa_K143002 1 amyE 3 IS 3??? Integration Sequence for the amyE locus of B. subtilis 2008-08-27T11:00:00Z 2015-05-08T01:10:23Z The 3??? integration sequence was taken from the shuttle vector pDR111 which has been used in many studies on B.subtilis, in particular in the studies of transcriptional control[1,2,3] References 1.Shimotsu H and Henner DJ. Construction of a single-copy integration vector and its use in analysis of regulation of the trp operon of Bacillus subtilis. Gene 1986; 43(1-2) 85-94. pmid:3019840. 2.Erwin KN, Nakano S, and Zuber P. Sulfate-dependent repression of genes that function in organosulfur metabolism in Bacillus subtilis requires Spx. J Bacteriol 2005 Jun; 187(12) 4042-9. doi:10.1128/JB.187.12.4042-4049.2005 pmid:15937167 3.Britton RA, Eichenberger P, Gonzalez-Pastor JE, Fawcett P, Monson R, Losick R, and Grossman AD. Genome-wide analysis of the stationary-phase sigma factor (sigma-H) regulon of Bacillus subtilis. J Bacteriol 2002 Sep; 184(17) 4881-90. pmid:12169614 Released HQ 2013 Integration sequences allow DNA to be incorporated into the chromosome of a host cell at a specific locus using leading (5') and trailing (3') DNA sequences that are the same as those at a specific locus of the chromosome. The 5' integration sequence can be added to the front of a Biobrick construct and the 3' integration sequence specific for this locus (Part BBa_K143002) to the rear of the Biobrick construct to allow integration of the Biobrick construct into the chromosome of the gram positive bacterium B.subtilis. The AmyE locus was the first locus used for integration into B.subtilis by Shimotsu and Henner[1] and is still commonly used in vectors such as pDR111[2], pDL[3] and their derivatives. Integration at the AmyE locus removes the ability of B.subtilis to break down starch, which can be assayed with iodine as described by Cutting and Vander-horn[4]. The 5' and 3' integration sequences for the AmyE locus were used to integrate the Imperial 2008 iGEM project primary construct into the B.sutbilis chromosome. References 1. Shimotsu H and Henner DJ. Construction of a single-copy integration vector and its use in analysis of regulation of the trp operon of Bacillus subtilis. Gene 1986; 43(1-2) 85-94. pmid:3019840 2.Nakano S, K�ster-Sch�ck E, Grossman AD, and Zuber P. Spx-dependent global transcriptional control is induced by thiol-specific oxidative stress in Bacillus subtilis. Proc Natl Acad Sci U S A 2003 Nov 11; 100(23) 13603-8. doi:10.1073/pnas.2235180100 pmid:14597697 3.Bacillus Genetic Stock Center; www.bgsc.org 4.Cutting, S M.; Vander-Horn, P B. Genetic analysis. In: Harwood C R, Cutting S M. , editors. Molecular biological methods for Bacillus. Chichester, England: John Wiley & Sons, Ltd.; 1990. pp. 27???74. false false _199_ 0 3475 9 In stock true The AmyE integration sequence was taken from the vector after comparison by BLAST to the B.subtilis chromosome to identify the homologous sequences. The sequence present in both the host chromosome and the plasmid at the 3' end of the gene is the 3' sequence required for integration true Chris Hirst annotation1974146 1 3' AmyE homologous sequence range1974146 1 1 1005 BBa_K143002_sequence 1 atccgtttaggctgggcggtgatagcttctcgttcaggcagtacgcctcttttcttttccagacctgagggaggcggaaatggtgtgaggttcccggggaaaagccaaataggcgatcgcgggagtgctttatttgaagatcaggctatcactgcggtcaatagatttcacaatgtgatggctggacagcctgaggaactctcgaacccgaatggaaacaaccagatatttatgaatcagcgcggctcacatggcgttgtgctggcaaatgcaggttcatcctctgtctctatcaatacggcaacaaaattgcctgatggcaggtatgacaataaagctggagcgggttcatttcaagtgaacgatggtaaactgacaggcacgatcaatgccaggtctgtagctgtgctttatcctgatgatattgcaaaagcgcctcatgttttccttgagaattacaaaacaggtgtaacacattctttcaatgatcaactgacgattaccttgcgtgcagatgcgaatacaacaaaagccgtttatcaaatcaataatggaccagagacggcgtttaaggatggagatcaattcacaatcggaaaaggagatccatttggcaaaacatacaccatcatgttaaaaggaacgaacagtgatggtgtaacgaggaccgagaaatacagttttgttaaaagagatccagcgtcggccaaaaccatcggctatcaaaatccgaatcattggagccaggtaaatgcttatatctataaacatgatgggagccgagtaattgaattgaccggatcttggcctggaaaaccaatgactaaaaatgcagacggaatttacacgctgacgctgcctgcggacacggatacaaccaacgcaaaagtgatttttaataatggcagcgcccaagtgcccggtcagaatcagcctggctttgattacgtgctaaatggtttatataatgactcgggcttaagcggttctcttccccattga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z