BBa_K143006 1 epsE 3 IS 3??? Integration Sequence for the epsE locus of B. subtilis 2008-09-11T11:00:00Z 2015-05-08T01:10:23Z The 3??? integration sequence was taken from the ''B.subtilis'' chromosome and is homologous to the middle section of the EpsE gene. It was produced by PCR cloning with Pfu DNA polymerase Integration sequences allow DNA to be incorporated into the chromosome of a host cell at a specific locus using leading (5') and trailing (3') DNA sequences that are the same as those at a specific locus of the chromosome. The 5' integration sequence can be added to the front of a Biobrick construct and the 3' integration sequence specific for this locus (Part BBa_K143005) to the rear of the Biobrick construct to allow integration of the Biobrick construct into the chromosome of the gram positive bacterium B.subtilis. The EpsE (aka YveO) locus has to our knowledge never been used for integration into ''B.subtilis'' before, but is useful in that it knocks out the potential molecular clutch EpsE gene <cite>#1</cite>. In particular, both the 5' and 3' integration sequences for the EpsE locus conatin in-frame stop codons to prevent translation of the gene (if nothing is integrated into the locus, integration also prevents correct EpsE expression). The 5' and 3' integration sequences for the EpsE locus were used to integrate over the EpsE gene and prevent its expression in the Imperial 2008 iGEM project ''B.sutbilis'' host. ===References=== <biblio> #1 pmid=18566286 </biblio> false false _199_ 0 3475 9 It's complicated false The EpsE integration sequences were designed from the EpsE (aka YveO) gene's Genbank entry<cite>#1</cite> and identification of the sequence directly upstream of the gene on the chromosome (found using NCBI's sequence viewer). The upstream and EpsE gene sequence was analysed for restriction sites and primers (with biobrick prefix and suffix sequences) for two approximately equally sized integration sequences were desgined. The integration sequences were then produced by PCR cloning with Pfu DNA polymerase ===Reference=== <biblio> #1 http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene, Gene ID:938633 </biblio> false Chris Hirst annotation1975712 1 In frame stop codon range1975712 1 12 14 annotation1975711 1 3??? EpsE Integration Sequence range1975711 1 1 462 BBa_K143006_sequence 1 cgcgccgtctgtaaaagcaggtcgcgtttttagaaaagcaccgacactatcaggtggttggcaccggcatgcttgtgtttgatgaatttggcgtaagaggcgcccgcattctgccttctgttccggagccgggcatcatggcaaaagggactccattttgccacggcacgattatgatgagagcgagtgcctaccgcacgctgaaaggctaccggtcggtgcggcggacgagacgaatggaagatattgatttgtggcttcgcttttttgaagagggcttcaggggctataatcttcaggaagccttgtataaagtgagggaagacagcgatgcattcaaacggcggtcatttacgtattcaatcgacaatgccattcttgtctatcaggcgtgcagacgcttgaagcttcctttatctgattacatatatatcgcaaaaccgttaattcgcgcctttatgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z