BBa_K143009 1 pyrD 3 IS 3??? Integration Sequence for the pyrD locus of B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The 3??? integration sequence was taken from the B.subtilis chromosome and is homologous to the back section of the PyrD gene. It was synthesised by Geneart. Integration sequences allow DNA to be incorporated into the chromosome of a host cell at a specific locus using leading (5') and trailing (3') DNA sequences that are the same as those at a specific locus of the chromosome. The 3' integration sequence can be added to the back of a Biobrick construct and the 5' integration sequence specific for this locus (BBa_K143008) to the front of the Biobrick construct to allow integration of the Biobrick construct into the chromosome of the gram positive bacterium B.subtilis. The PyrD gene has been a target for numerous integration vectors, including the shuttle vectors pPyr-Cm (GenBank Accession number AY464558) and pPyr-Kan (GenBank Accession number AY464559) [1]. Integration into the PyrD locus makes the B.subtilis auxotrophs for uracil and transformants require about 40ug/ml to allow for growth. This allows us to assay for integration by growing a replica plate with no supplemented uracil to negatively select for transformants. false false _199_ 0 2090 9 It's complicated false The PyrD integration sequences was designed from the PyrD gene's Genbank entry[1] and identification of the sequence directly upstream of the gene on the chromosome (found using NCBI's sequence viewer). The upstream and EpsE gene sequence was analysed for restriction sites and primers (with biobrick prefix and suffix sequences) for two approximately equally sized integration sequences were desgined. false James Chappell annotation1977517 1 PyrD 3' Integration Sequence range1977517 1 1 467 BBa_K143009_sequence 1 gatgtacccgtttatgtgaagctatccccgaacgtggctaatatcacagaaattgcattagcgatcgaggaagcgggagcggacggtcttacgatgatcaacacactaatcggcatgagactcgatttaaaaaccggcaaaccgatattagcgaataaaacagggggactttcgggccctgctgtgaagccggttgccattcgcatggtgtatgaagtcagccagatggtcaacatcccgattatcggaatgggaggcgtgcaaacggctgaagatgccctggaatttcttctcgcgggagcaagcgcagtcgctgtcggaacagcaaactttgtgaatccttttgcatgtccagagattattgaacagctcccatctgttttgctccaatacggctatcaatcaattgaagaatgcatcggaaggagctggaatcatgaaaaacaacctgcccatcatcgcgcttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z