BBa_K143012 1 Pveg Promoter veg a constitutive promoter for B. subtilis 2008-09-10T11:00:00Z 2015-05-08T01:10:23Z The Pveg promoter was suggested to us by Dr. Jan-Willem Veening of Newcastle University. This sequence supplied was compared to that of the DBTBS database<cite>#3</cite> then a section containing the binding site synthesised by Geneart. Released HQ 2013 Pveg is a constitutive promoter that constitutively expresses the P43 protein in ''B.subtilis''. Pveg contains binding sites for the ''B.sutbilis'' major sigma factor<cite>#1</cite>. Pveg in ''B.subtilis'' utilises two binding sites to cause high expression of genes<cite>#2</cite>, however our Pveg is lacking the upstream site to give a medium level of gene expression. It has been noted that the sporulation master regulatoion factor spoOA interacts with Pveg though it is not known how<cite>#3</cite>. The context with which we used the promoter Pveg is as a '''Polymerase Per Second''' (PoPS) generator. false true _199_ 0 2090 9 In stock false The biobrick part was designed to include a single binding site for the ''B.subtilis major sigma factor. In addition the biobrick standard was applied to the promoter Pveg sequence. false James Chappell annotation1975704 1 Sigma A-35 range1975704 1 63 68 annotation1975705 1 Sigma A -10 range1975705 1 86 91 BBa_K143012_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z