BBa_K143013 1 P43 Promoter 43 a constitutive promoter for B. subtilis 2008-09-10T11:00:00Z 2015-05-08T01:10:23Z The part was designed using the sequence from the ''B.subtilis'' genome and from previously published papers <cite>2</cite>. This sequence was then synthesised by Geneart. Promoter 43 is a constitutive promoter that constitutively expresses the P43 protein in ''B.subtilis''. This promoter has been shown to be recognized and active during the exponential and lag phases of growth. It has been hypothesized that the ability to recognize the promoter in exponential and lag phase of growth is due to the recognition of the promoter by both sigma factor 55 (the major sigma factor) and sigma factor 37 (the lag phase sigma factor) <cite>1</cite>. The P43 promoter has been previously used for constitutive expression of exogenous genes within ''B.subtilis'' vectors <cite>2</cite>. The context with which we used the promoter P43 is as a '''Polymerase Per Second''' (PoPS) generator. false false _199_ 0 2090 9 Not in stock false The biobrick part was designed to include the binding sites for both the sigma factor A and B. In addition the biobrick standard was applied to the promoter P43 sequence. false James Chappell annotation1975706 1 Sigma B -35 range1975706 1 14 22 annotation1975708 1 Sigma A -35 range1975708 1 24 29 annotation1975707 1 Sigma B -10 range1975707 1 38 47 annotation1975709 1 Sigma A -10 range1975709 1 47 52 BBa_K143013_sequence 1 attttacatttttagaaatgggcgtgaaaaaaagcgcgcgattatgtaaaatataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z