BBa_K143014 1 Pxyl Promoter Xyl for B.subtilis 2008-09-14T11:00:00Z 2015-05-08T01:10:23Z The part was designed using the sequence from the ''B.subtilis'' genome and from previously published papers <cite>1</cite><cite>2</cite>. This sequence was then synthesised by Geneart. Promoter Xylose is an inducible promoter that has been designed for high expression in ''B.subtilis''. Gene expression under the promoter xylose can be induced by addition of xylose. The context with which we used the promoter xylose, was to take an input of xylose and give '''Polymerase Per Second'''(PoPS) as an output.<br> Promoter xylose is an inducible promoter that has been designed for high expression in ''B.subtilis''. Gene expression under the promoter xylose can be induced by addition of xylose. The context with which we used the promoter xylose, was to take an input of xylose and give '''Polymerase Per Second'''(PoPS) as an output. Xylose does not induce the promoter xylose directly, but requires the transcriptional regulator '''XylR''', (<bbpart>BBa_K143036</bbpart>) This means that XylR must be constitutively expressed in ''B.subtilis'' in order to use the promoter xylose. false false _199_ 0 2090 9 Not in stock false Biobrick standard was applied to the promoter xylose sequence. false James Chappell annotation1975868 1 XylR Operator range1975868 1 51 61 annotation1976429 1 Sigma A -10 range1976429 1 36 41 annotation1975869 1 XylR Operator range1975869 1 65 75 annotation1976428 1 Sigma A -35 range1976428 1 13 18 BBa_K143014_sequence 1 ctaaaaaaaatattgaaaatactgacgaggttatataagatgaaaataagttagtttgtttaaacaacaaactaataggtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z