BBa_K143015 1 Ph-s Promoter hyper-spank for B. subtilis 2008-09-17T11:00:00Z 2015-05-08T01:10:23Z The part was designed using the sequence from the ''B.subtilis'' genome and from previously published papers <cite>1</cite><cite>2</cite><cite>3</cite>. This sequence was then synthesised by Geneart. Promoter hyper-spank is an inducible promoter that has been designed for high expression in ''B.subtilis''. Gene expression under the promoter hyper-spank can be induced by addition of Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG). The context with which we used the promoter hyper-spank, was to take an input of IPTG and give '''Polymerase Per Second'''(PoPS) as an output. IPTG does not induce the promoter hyper-spank directly, but requires the transcriptional regulator '''LacI''', (<bbpart>BBa_K413035</bbpart>). This means that LacI must be constitutively expressed in ''B.subtilis'' in order to use the promoter hyper-spank. false false _199_ 0 3475 9 Not in stock false Biobrick standard was applied to the promoter hyper-spank sequence. false Chris Hirst annotation1976423 1 LacI Operator range1976423 1 10 30 annotation1976425 1 Sigma A -10 range1976425 1 69 74 annotation1976426 1 LacI Operator range1976426 1 81 101 annotation1976424 1 Sigma A -35 range1976424 1 46 50 BBa_K143015_sequence 1 ctcgagggtaaatgtgagcactcacaattcattttgcaaaagttgttgactttatctacaaggtgtggcataatgtgtgtaattgtgagcggataacaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z