BBa_K143032 1 EpsE EpsE Molecular Clutch Gene of B. subtilis 2008-09-17T11:00:00Z 2015-05-08T01:10:24Z The epsE gene sequence was taken from the ''B. subtilis'' chromosome and was synthesised by GeneArt. Released HQ 2013 The epsE gene of the exopolysaccharide synthesis operon of ''B. subtilis'' has been suggested to function in a manor similar to a molecular clutch<cite>#1</cite>. If expressed inside a cell it will prevent flagellar movement causing the cell to no longer be able to swim effectively and instead only tumble. As such EpsE could potentially be used as a controller of ''B. subtilis'' movement. Though the EPS operon is normally repressed in ''B. subtilis'', if EpsE is synthetically expressed it would be beneficial for the original copy of epsE to be knocked out. This can be achieved by integrating over the EesE gene with the epsE integration Biobricks (<bbpart>BBa_K143005</bbpart> and <bbpart>BBa_K143006</bbpart>) which contain 2 in-frame stop codons. Although many bacterial flaggelar assemblies contain proteins that are similar in shape, there is no guarantee that the epsE gene will function correctly in any host cell other than ''B. subtilis'' false false _199_ 0 3475 9 In stock true The epsE(aka yveO) sequence was located in the ''B. subtilis'' chromosome<cite>#1</cite> and the ''Pst''I restriction site removed before synthesis by GeneArt true Chris Hirst annotation1976430 1 EpsE Molecular Clutch Gene range1976430 1 1 834 annotation1992701 1 stop range1992701 1 835 837 annotation1992699 1 start range1992699 1 1 3 annotation1992700 1 stop range1992700 1 838 840 BBa_K143032_sequence 1 atgaactcaggaccgaaagtttctgtcattatgggcatttataattgcgaacgcactttggcagaaagcatagaatccatactcagccaatcctataaaaattgggagctgattttgtgcgatgatgcgtcaacagacggcacgctccgtatcgcgaagcagtatgccgctcattacagcgaccgcatcaaactgattcaaaacaaaacaaataagcggcttgccgcatcattaaatcattgtctttcgcatgcgacaggcgattatatcgaacgtcaggacggagatgacctttcgtttccgcgccgtctggaaaagcaggtcgcgtttttagaaaagcaccgacactatcaggtggttggcaccggcatgcttgtgtttgatgaatttggcgtaagaggcgcccgcattctgccttctgttccggagccgggcatcatggcaaaagggactccattttgccacggcacgattatgatgagagcgagtgcctaccgcacgctgaaaggctaccggtcggtgcggcggacgagacgaatggaagatattgatttgtggcttcgcttttttgaagagggcttcaggggctataatcttcaggaagccttgtataaagtgagggaagacagcgatgcattcaaacggcggtcatttacgtattcaatcgacaatgccattcttgtctatcaggcgtgcagacgcttgaagcttcctttatctgattacatatatatcgcaaaaccgttaattcgcgcctttatgccggcagctgtgatgaatcgctaccataaaaaaagagtgatgaaccaaaaggaagggcttgtcaagcatgaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z