BBa_K143033 1 LacI LacI (Lva^-, N-terminal deletion) regulatory protein 2008-09-15T11:00:00Z 2015-05-08T01:10:24Z The LacI gene was cloned from''B. subtilis'' shuttle vector pDR111 using Pfu DNA polymerase PCR LacI is a regulatory protein responsible for the repression of many catabolite genes. Transcription is regulated by proteins which bind operator sequences around the transcription start site. These proteins can positively affect transcription (activators) or negatively affect transcription (reppresors). Some repressor proteins can be inactivted however by addition of an inducer, such as IPTG or certain sugars. LacI if the regulator protein for the lactose operon in ''E.coli'' and the hyper-spank protein of ''B. subtilis''<cite>#1</cite>(<bbpart>BBaK143015</bbpart>) and is responsible for ensuring that in the absence of lactose (or IPTG) that there is no expression trough these promoter. LacI is not endogenous to ''B. subtilis'', so LacI will need to be expressed in the host in order for the hyper-spank promoter to be regulated. In the presence of IPTG or lactose, the LacI tetramer is unable to bind DNA and so transcription resumes. This version of LacI lacks a Lva degradation tag and has a small(3 amino acid) N-terminal deletion relative to the current registry LacI (<bbpart>BBa_C0012</bbpart)> and is derivatives. The N-terminal deletion appears to be common to most of the LacI genes used in conjunction with ''B. subtilis'' though both forms are found in ''E.coli'' (in differing strains). LacI was used in conjunction with the '''Hyper-spank promoter''' (<bbpart>BBa_K143015<bbpart>) and acted as an input adaptor for a '''Polymerases per second''' (POPS) output ====References==== <biblio> #1 pmid=16166525 </biblio> false false _199_ 0 3475 9 It's complicated false LacI was located in the sequence of the ''B. subtilis'' shuttle vector pDR111. This version of LacI lacks a Ltva degradation sequence and has a small N-terminal deletion that is observed in many LacI used in studies on ''B.subtilis''. In particular, this LacI protein is used in pDR111 to regulate expression of the inducible Phyper-spank protein (<bbpart>BBa_K143015</bbpart>) (also used in the pDR111 vector). The BioBrick prefix and suffix were applied to the gene false Chris Hirst annotation1994271 1 stop range1994271 1 1081 1083 annotation1994272 1 stop range1994272 1 1084 1086 annotation1975974 1 LacI (Lva-, N-terminal deletion) regulatory protein range1975974 1 1 1080 annotation1992702 1 start range1992702 1 1 3 BBa_K143033_sequence 1 atgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaaacggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgtcaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z