BBa_K143034 1 LipA-EAK16 LipA-EAK16-II Fusion Protein 2008-09-17T11:00:00Z 2015-05-08T01:10:24Z EAK16-II was identified as a region in zuotin, a Z-DNA binding protein from the yeast genome. LipA originated from the B. subtilis genome<cite>3</cite>. Both components were produced as a fusion protein by GeneArt. EAK16-II is a sixteen amino acid peptide that self-assembles to form &#946;-sheet structures in an aqueous medium. The alternating positive and negative charges (--++--++) are responsible for creating an electrostatic attraction between adjacent peptides <cite>1</cite>, triggering self-assembly when the EAK16-II peptides are exposed to physiological media or salt solution. When examined under SEM, a well-ordered nanofibre structure is formed by the association of the EAK16-II peptides and these nanofibres can futher aggregate to form a membranous 3D scaffold. LipA is a signal peptide from the B.subtilis genome. In general, signal peptides are responsible for directing preproteins (secretory proteins with a signal peptide region attached)through an appropriate secretory pathway<cite>2</cite>. LipA has been successfully used in the secretion of heterologous proteins such as cutinase by ''B. subtilis''. false false _199_ 0 3429 9 It's complicated false BioBrick standard was applied to LipA-EAK16II Fusion Protein. false Qin Qi annotation1992704 1 stop range1992704 1 154 156 annotation1976427 1 LipA range1976427 1 1 102 annotation1992703 1 EAK16-II range1992703 1 103 150 annotation1992706 1 start range1992706 1 1 3 annotation1992705 1 stop range1992705 1 151 153 BBa_K143034_sequence 1 atgaaatttgtgaaaagacgcattattgcactggttacaattctgatgctgtcagttacatcactgtttgcactgcaaccgtcagcaaaagcagcagaacatgcagaagcagaagcgaaagcaaaagcggaagctgaagccaaagcgaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z